View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2992_high_14 (Length: 237)

Name: NF2992_high_14
Description: NF2992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2992_high_14
NF2992_high_14
[»] chr2 (1 HSPs)
chr2 (1-222)||(17595183-17595404)


Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 17595183 - 17595404
Alignment:
1 aattggaatagtatcagtgatattaaccatattgtttgctcttttttgttactttgtgttacgccctccactcaacaaaataatagtnnnnnnnncagat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||    
17595183 aattggaatagtatcagtgatattaaccatattgtttgctcttttttgttactttgtgttacgccctccactcaacaaaataatagtaaaaaaaacagat 17595282  T
101 gaagataaatgggatgcataccaattaacctatgtattagttggtgttattgcatgtgcaactgttactgaatttcttggtacacattcagttgttggag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
17595283 gaagataaatgggatgcataccaattaacctatgtattagttggtgttattgcatgtgcaactgttactgaatttcttggtacacattctgttgttggag 17595382  T
201 cattgatttttgggttaattct 222  Q
    ||||||||||||||||||||||    
17595383 cattgatttttgggttaattct 17595404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University