View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2992_low_23 (Length: 236)
Name: NF2992_low_23
Description: NF2992
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2992_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 30351554 - 30351779
Alignment:
| Q |
1 |
attctagaccacccctacttgcaatttcttgcaaccgttcatgtaagagtatagtctccttt-----gtgtcaaatttatccgagacaaattcaaaatag |
95 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
30351554 |
attctaggccacccctacttacaatttcttgcaaccgttcatgtaagagtatggtctcctttaatttgtgtcaaatttatccacgacaaattcaaaatag |
30351653 |
T |
 |
| Q |
96 |
aatatgatcaggaatgtgtcaatggaattagatgagaatgaaattacataagcataatatatcaaaggtgaaacaatagtcaaggatttgtatattaatg |
195 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30351654 |
aatatgatcaggaatgtctcaatggaattagatgagaatgaaattacataagcataatatatcaaaggtgaaacaatagtcaaggatttgtatattaatg |
30351753 |
T |
 |
| Q |
196 |
tattcaaagaaggatcacgttgtttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
30351754 |
tattcaaagaaggatcacgttgtttt |
30351779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University