View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2993_high_16 (Length: 224)
Name: NF2993_high_16
Description: NF2993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2993_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 110 - 207
Target Start/End: Complemental strand, 27800589 - 27800493
Alignment:
| Q |
110 |
gcaactaattgattagttgaatggttacaattgcaatgcatagccatttcaatatacacaaactatccaacaatagaatcccttgtaattataacttc |
207 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27800589 |
gcaactaattgattagttgaatagt-acaattgcaatgcatagccattgcaatatacacaaactatcaaacaatagaatcccttgtaattataacttc |
27800493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 27800640 - 27800590
Alignment:
| Q |
17 |
acttaaagtgtcattgagccatataggcaacgcataatgaacttgtctttg |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27800640 |
acttaaagtgtcattgagccatataggcaacgcataatgaacttgtctttg |
27800590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University