View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2993_low_23 (Length: 224)

Name: NF2993_low_23
Description: NF2993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2993_low_23
NF2993_low_23
[»] chr7 (2 HSPs)
chr7 (110-207)||(27800493-27800589)
chr7 (17-67)||(27800590-27800640)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 110 - 207
Target Start/End: Complemental strand, 27800589 - 27800493
Alignment:
110 gcaactaattgattagttgaatggttacaattgcaatgcatagccatttcaatatacacaaactatccaacaatagaatcccttgtaattataacttc 207  Q
    |||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
27800589 gcaactaattgattagttgaatagt-acaattgcaatgcatagccattgcaatatacacaaactatcaaacaatagaatcccttgtaattataacttc 27800493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 17 - 67
Target Start/End: Complemental strand, 27800640 - 27800590
Alignment:
17 acttaaagtgtcattgagccatataggcaacgcataatgaacttgtctttg 67  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
27800640 acttaaagtgtcattgagccatataggcaacgcataatgaacttgtctttg 27800590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University