View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2993_low_25 (Length: 218)

Name: NF2993_low_25
Description: NF2993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2993_low_25
NF2993_low_25
[»] chr1 (2 HSPs)
chr1 (75-202)||(1592795-1592922)
chr1 (9-75)||(1593301-1593368)


Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 75 - 202
Target Start/End: Complemental strand, 1592922 - 1592795
Alignment:
75 taatgagaacatttagaagtaattgaagagcgttcaaaagattcaagactgactttgcactaaatcaaattggtgccaatgatgttccaaatgttactaa 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1592922 taatgagaacatttagaagtaattgaagagcgttcaaaagattcaagactgactttgcactaaatcaaattggtgccaatgatgttccaaatgttactaa 1592823  T
175 ctattgcaccgagtttgctagcaatttc 202  Q
    ||||||||||||||||||||||||||||    
1592822 ctattgcaccgagtttgctagcaatttc 1592795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 1593368 - 1593301
Alignment:
9 cgactgaa-atgaatagtatcatcgttgcgccgtataatcagagaactagatgttagacacccttatt 75  Q
    |||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||    
1593368 cgactgaacatgaatagtatcatcgttgcgccgtaaaatcagaaaactagatgttagacacccttatt 1593301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University