View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2993_low_25 (Length: 218)
Name: NF2993_low_25
Description: NF2993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2993_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 75 - 202
Target Start/End: Complemental strand, 1592922 - 1592795
Alignment:
| Q |
75 |
taatgagaacatttagaagtaattgaagagcgttcaaaagattcaagactgactttgcactaaatcaaattggtgccaatgatgttccaaatgttactaa |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1592922 |
taatgagaacatttagaagtaattgaagagcgttcaaaagattcaagactgactttgcactaaatcaaattggtgccaatgatgttccaaatgttactaa |
1592823 |
T |
 |
| Q |
175 |
ctattgcaccgagtttgctagcaatttc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1592822 |
ctattgcaccgagtttgctagcaatttc |
1592795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 1593368 - 1593301
Alignment:
| Q |
9 |
cgactgaa-atgaatagtatcatcgttgcgccgtataatcagagaactagatgttagacacccttatt |
75 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
1593368 |
cgactgaacatgaatagtatcatcgttgcgccgtaaaatcagaaaactagatgttagacacccttatt |
1593301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University