View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994R-Insertion-13 (Length: 390)
Name: NF2994R-Insertion-13
Description: NF2994R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994R-Insertion-13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 9 - 377
Target Start/End: Complemental strand, 38649335 - 38648967
Alignment:
| Q |
9 |
ggatttgggggttagcgttttaattttcatattcaatgtttcttgtctagggttatttgaatctgttctgttattgattgctctaaaaattcattcgatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38649335 |
ggatttgggggttagcgttttaattttcttattcaatgtttcttgtctagggttatttgaatctgttctgttattgattgctctaaaaattcattcgatt |
38649236 |
T |
|
| Q |
109 |
tctcggatttgggggctagggtttaaaccgtatgaattggggattttttgtttggttctgtgatggaataattaaacttattttctctcctttttatgtt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38649235 |
tctcggatttgggggctagggtttaaaccgtatgaattggggattttttttttggttctgtgatggaataattaaacttattttctctcctttttatgtt |
38649136 |
T |
|
| Q |
209 |
ttaatttgccaattcaatgctttttgtcttatatactcatttctcatattgatccaataattaagcattaaggatgtaacaacataatatcagctttgtt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38649135 |
ttaatttgccaattcaatgctttttgtcttatatactcatttctcatattgatccaataattaagcattaaggatgtaacaacataatatcagctttgtt |
38649036 |
T |
|
| Q |
309 |
ctcgcatatctgtgcagacaagtctctctccccaatcacatctcacacaagcaaaaatggtttattgta |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38649035 |
ctcgcatatctgtgcagacaagtctctctccccaatcacatctcacacaagcaaaaatggtttattgta |
38648967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University