View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994R-Insertion-17 (Length: 223)
Name: NF2994R-Insertion-17
Description: NF2994R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994R-Insertion-17 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 223
Target Start/End: Complemental strand, 39319039 - 39318824
Alignment:
| Q |
8 |
agtttgtgcatcatacatatgtgaggaaggcttgattttcgagttgttagttgtttgaatgggaaccttacgaagcggtgtgccatcaatgtctatcttt |
107 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39319039 |
agtttgtgcatcttacatatgcgaggaaggcttgattttcgagttgttagttgtttgaatgggaaccttacgaagcggtgtgccatcaatgtctatcttt |
39318940 |
T |
|
| Q |
108 |
gtctattatgtgtcgttaggaagtttgagagtgaatggtccttggttagtcgttggaggcatttgggaagcaggatggatccaaggttgttgacttggtt |
207 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39318939 |
gtctattatgtgtcgttaggacgtttgagagtgaacggtccttggttagtcgttggaggcatttgggaagcaggatggatccaaggttgttgacttggtt |
39318840 |
T |
|
| Q |
208 |
cgatgattgagtttgg |
223 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39318839 |
cgatgattgagtttgg |
39318824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University