View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994R-Insertion-18 (Length: 204)
Name: NF2994R-Insertion-18
Description: NF2994R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994R-Insertion-18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 204
Target Start/End: Original strand, 43771584 - 43771779
Alignment:
| Q |
9 |
tgtacaggtattatctatgctaatttattgctgaaaagttaaaaattgcagtacctttgtttcttgaattgtgatctggttgtcctttaatttatttgga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43771584 |
tgtacaggtattatctatgctaatttattgctgaaaagttaaaaattgcagtacctttgtttcttgaattgtgatctggttgtccttttatttatttgga |
43771683 |
T |
 |
| Q |
109 |
aagtagttttttgaaggtagtaaattagcagtacatttatttttgtaattatggttttgcagacaatgtttacatctcagatgtcagcagttcttt |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43771684 |
aagtacttttttgaaggtagtaaattagcagtacatttatttttgtaattatggttttgcagacaatgtttacatctcagatgtcagcagttcttt |
43771779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University