View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2994R-Insertion-19 (Length: 143)

Name: NF2994R-Insertion-19
Description: NF2994R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2994R-Insertion-19
NF2994R-Insertion-19
[»] chr5 (1 HSPs)
chr5 (9-143)||(14582292-14582426)


Alignment Details
Target: chr5 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 9 - 143
Target Start/End: Complemental strand, 14582426 - 14582292
Alignment:
9 tgttttaagaaccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaagtcttgatggattggtttagaggatgcttaaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14582426 tgttttaagaaccatggattgatttttgccaacaaagaagcttcatccttattacaaacaagattcaagtcttgatggattggtttagaggatgcttaaa 14582327  T
109 gggctccacatagaaaggtagtggggaagttggtg 143  Q
    |||||||||||||||||||||||||||||||||||    
14582326 gggctccacatagaaaggtagtggggaagttggtg 14582292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University