View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994R-Insertion-21 (Length: 64)
Name: NF2994R-Insertion-21
Description: NF2994R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994R-Insertion-21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 5e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 9 - 64
Target Start/End: Complemental strand, 4014321 - 4014266
Alignment:
| Q |
9 |
tccacatcacaaactatctactctttcacccttttcaaccttctcttcaaaacctc |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4014321 |
tccacatcacaaactatctactctttcacccttttcaaccttctcttcaaaacctc |
4014266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 9 - 64
Target Start/End: Original strand, 13974875 - 13974930
Alignment:
| Q |
9 |
tccacatcacaaactatctactctttcacccttttcaaccttctcttcaaaacctc |
64 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13974875 |
tccacatcacaaaatatcaactctttcacccttttcaaccttctcttcaaaacctc |
13974930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University