View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994R-Insertion-22 (Length: 57)
Name: NF2994R-Insertion-22
Description: NF2994R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994R-Insertion-22 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 26955855 - 26955903
Alignment:
| Q |
9 |
catttttctccttcttccactttgattcgaaaatcatctacgccatgtc |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26955855 |
catttttctccttcttccactttgattcgaaaatcataaacgccatgtc |
26955903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.000000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.000000000000004
Query Start/End: Original strand, 9 - 57
Target Start/End: Original strand, 40947125 - 40947173
Alignment:
| Q |
9 |
catttttctccttcttccactttgattcgaaaatcatctacgccatgtc |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40947125 |
catttttctccttcttccactttgattcgaaaatcataaacgccatgtc |
40947173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University