View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994R-Insertion-23 (Length: 43)
Name: NF2994R-Insertion-23
Description: NF2994R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994R-Insertion-23 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 38413048 - 38413014
Alignment:
| Q |
9 |
gtctctgcctttgaggctgttgttcttgttctcac |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38413048 |
gtctctgcctttgaggctgttgttcttgttctcac |
38413014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 9 - 43
Target Start/End: Complemental strand, 38422935 - 38422901
Alignment:
| Q |
9 |
gtctctgcctttgaggctgttgttcttgttctcac |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38422935 |
gtctctgcctttgaggctgttgttcttgttctcac |
38422901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University