View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2994_high_17 (Length: 260)
Name: NF2994_high_17
Description: NF2994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2994_high_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 30 - 260
Target Start/End: Original strand, 38648967 - 38649197
Alignment:
| Q |
30 |
tacaataaaccatttttgcttgtgtgagatgtgattggggagagagacttgtctgcacagatatgcgagaacaaagctgatattatgttgttacatcctt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38648967 |
tacaataaaccatttttgcttgtgtgagatgtgattggggagagagacttgtctgcacagatatgcgagaacaaagctgatattatgttgttacatcctt |
38649066 |
T |
 |
| Q |
130 |
aatgcttaattattggatcaatatgagaaatgagtatataagacaaaaagcattgaattggcaaattaaaacataaaaaggagagaaaataagtttaatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38649067 |
aatgcttaattattggatcaatatgagaaatgagtatataagacaaaaagcattgaattggcaaattaaaacataaaaaggagagaaaataagtttaatt |
38649166 |
T |
 |
| Q |
230 |
attccatcacagaaccaaacaaaaaatcccc |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |
|
|
| T |
38649167 |
attccatcacagaaccaaaaaaaaaatcccc |
38649197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University