View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2995_low_10 (Length: 292)
Name: NF2995_low_10
Description: NF2995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2995_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 18 - 277
Target Start/End: Original strand, 41936490 - 41936749
Alignment:
| Q |
18 |
gatattaattgattgatgggatgggtggaacagtgaatataaacgagttcaggtttgattatattagggctatgtccaatcaaggatataaaggagtata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936490 |
gatattaattgattgatgggatgggtggaacagtgaatataaacgagttcaggtttgattatattagggctatgtccaatcaaggatataaaggagtata |
41936589 |
T |
|
| Q |
118 |
tgtcctaccattaccaacaagttctttatacctggtcccattaatggtgtctcccttctctcnnnnnnngcccaaggtgaaaagtgccacagccttcatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41936590 |
tgtcctaccattaccaacaagttctttatacctggtcctattaatggtgtctcccttctctctttttttgcccaaggtgaaaagtgccacagccttcatg |
41936689 |
T |
|
| Q |
218 |
tgctgcttcaattcctgattagctgggtaacataacacaacacaaaaatggtttcatttt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41936690 |
tgctgcttcaattcctgattagctgggtaacataacacaacacaaaaatggtttcatttt |
41936749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University