View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2995_low_11 (Length: 282)
Name: NF2995_low_11
Description: NF2995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2995_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 16 - 264
Target Start/End: Complemental strand, 5568809 - 5568561
Alignment:
| Q |
16 |
aaggcattaaaaataaccaaacacttgacactgcattcaaagtaatgagcttcttggtatgaagaatgacctagaattcctcttgacaaatgataaaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5568809 |
aaggcattaaaaataaccaaacacttgacactgcattcaaagtaatgagcttcttggtatgaagaatgacctagaattcctcttgacaaatgataaaaca |
5568710 |
T |
 |
| Q |
116 |
atgagctttccaactcatttgaatgaaagtaaatcatcttgaacaaatctctcatgttattttcatgcaccaaaacactcctgttctattcgacacagga |
215 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5568709 |
atgggctttccaactcatttgaatgaaagtaaatcatcttgaacaaatctctcatgttattttcatgcaccaaaacactcctgttctattcgacacagga |
5568610 |
T |
 |
| Q |
216 |
gcctaaaaggatcactaagaagggtgatctcaactccccatgaatctac |
264 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5568609 |
gcctaaaaggatcgctaagaagggtgatctcaactccccatgaatctac |
5568561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University