View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2995_low_12 (Length: 281)
Name: NF2995_low_12
Description: NF2995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2995_low_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 281
Target Start/End: Complemental strand, 17775787 - 17775525
Alignment:
| Q |
17 |
agaactgagatctgaaatttgatttaatttcaatgttttttatatctcttggctgctggtggtattggactattgttcatcataggtttgannnnnnnaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17775787 |
agaactgagatctgaaatttgatttaatttcaatatttc--atatctcttggctgctggtggtattggactattgttcatcataggtttgatttttttaa |
17775690 |
T |
 |
| Q |
117 |
gaaaaagtataccaagtgggttgtggtgtcacgttcatatagcttttgtttttcttgtatatactagttagtatatatgtatgaatgaatcattacaagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
17775689 |
gaaaaagtataccaagtgggttgtggtgtcacgttcatatagcttttgtttttcttgtatatactaattagtatatatgtatgtatgaatcattacaagg |
17775590 |
T |
 |
| Q |
217 |
atgaatgaatgttttcttattnnnnnnntgtggaagacattattgcagagtagcgtgcatacatt |
281 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17775589 |
atgaatgaatgttttcttattaaaaaaatgtggaagacattattgcagagtagcgtgcatacatt |
17775525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University