View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2995_low_13 (Length: 280)
Name: NF2995_low_13
Description: NF2995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2995_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 4885316 - 4885463
Alignment:
| Q |
1 |
tgatgctgccactgatttcttctactcgaccgttgcagtgtactatacggatcacatcaagtgctccacatggtagaatgcaagatatgcaacatcttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4885316 |
tgatgctgccactgatttcttctactcgaccgttgcagtgtactatacggatcacatcaagtgctccacatggtagaatgcaagatatgcaacatcttat |
4885415 |
T |
|
| Q |
101 |
gctgtttctcatagtttcttcttctccttgtatttcatttaatctcat |
148 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4885416 |
gctgtttctcatagtttcttcttctccttttatttcatttaatctcat |
4885463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University