View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2996_low_19 (Length: 217)
Name: NF2996_low_19
Description: NF2996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2996_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 10412814 - 10413014
Alignment:
| Q |
1 |
catacattagagtatagcttgtcaatctgggtctgtctgtactggctgtggtactatatatctatgttcatgaacttggcagattcgagggccaactata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10412814 |
catacattagagtatagcttgtcaatctgggtctgtctgtactggctgtggtactagatatctatgttcatgaacttggcagattcgagggccaac--ta |
10412911 |
T |
 |
| Q |
101 |
tgtttcatttgatggcattgcc-tttttatttattgtatatgaaatgatgatgagcatgtacatgtgagccacacaggtgtctcgctgttgttgcctttg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10412912 |
tgtttcatttgatggcattgccttttttatttattgtatatgaaatgatgatgagcatgtacatgtgagccacacaggtgtctcgctgttgttgcctttg |
10413011 |
T |
 |
| Q |
200 |
ctt |
202 |
Q |
| |
|
||| |
|
|
| T |
10413012 |
ctt |
10413014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University