View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2998_high_9 (Length: 202)
Name: NF2998_high_9
Description: NF2998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2998_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 11 - 161
Target Start/End: Original strand, 6495422 - 6495579
Alignment:
| Q |
11 |
agattatactaaatagtgatgcattacaaaataacaaatgaaataatgctaaaagttttcgttaaaagatattccaac-------ttgcaaccactaatc |
103 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
6495422 |
agattataataaacagtgatgcattacaaaataacaaatgaaataatactaaaagtttttgttaaaagatattccaactcacaacttgcaaccactaatc |
6495521 |
T |
 |
| Q |
104 |
atccaaggaggaaaacgataaccataaaacccaattcaacgtttcaatcaattgaata |
161 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6495522 |
atctaaggaggaaaacgataaccataaaacccaattcaacgtttcaatcaatggaata |
6495579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University