View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2998_low_3 (Length: 435)
Name: NF2998_low_3
Description: NF2998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2998_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 401; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 1 - 417
Target Start/End: Original strand, 52860793 - 52861209
Alignment:
| Q |
1 |
actcattctccggcaacattccggggaacttttcgtccaaatctcagcttcagctcatcaatctttcacataatgagttcaccggtggaataccggttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
52860793 |
actcattctccggcaacattccggggaacttttcgtccaaatctcaccttcagctcatcaatctttcacataatgacttcaccggtggaataccgtttac |
52860892 |
T |
|
| Q |
101 |
tgtcggagcattacagcatttggagtatctgtggttagacagcaaccatcttcatggaacgttaccttctgctgttgcaaactgttcttctatggtgcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860893 |
tgtcggagcattacagcatttggagtatctgtggttagacagcaaccatcttcatggaacgttaccttctgctgttgcaaactgttcttctatggtgcac |
52860992 |
T |
|
| Q |
201 |
cttagtgcagaggataatttcattggtgggttcgttccttctacgatagggactatgccaaagcttcaagtgctgtcactttccaggaatcaactttctg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52860993 |
cttagtgcagaggataatttcattggtgggttcgttccttccacgatagggactatgccaaagcttcaagtgctgtcactttccaggaatcaactttctg |
52861092 |
T |
|
| Q |
301 |
gttttgtccccacaacactgttttgcaatgaagacaacaacaataataacaatgctactaatcttcgtattgttcaacttgggtttaataggatcacggg |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52861093 |
gttttgtccccacaacactgttttgcaatgaagacaacaacaataataacaatgctactaatcttcgtattgttcaacttgggtttaataggatcacggg |
52861192 |
T |
|
| Q |
401 |
tatttcaaaccctcaaa |
417 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52861193 |
tatttcaaaccctcaaa |
52861209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University