View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2998_low_8 (Length: 239)
Name: NF2998_low_8
Description: NF2998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2998_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 13909621 - 13909848
Alignment:
| Q |
1 |
caaaattgttgtttacatggttctaagttgcggttgcagttatactacaaatatttaaattgtagtaaaatatggtcgatgtggtcgaaattgcagtagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13909621 |
caaaattgttgtttacatggttctaagttgcggttgcagttatactacaaatatttaaattgtagtaaaatatggtcgatgtggtcgaaattgcagtagt |
13909720 |
T |
 |
| Q |
101 |
gattacgaagaattcaaaaccttttatattgtggcacacatactcaaatttgatgattttgaatttaatgaacataggtatggagatatattcaagacac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13909721 |
gattacgaagaattcaaaaccttttatattgtggcacacatactcaaatttgatgattttgaatttaatgaacataggtatggagatatattcaagacac |
13909820 |
T |
 |
| Q |
201 |
acatactaggttgtccttgtgtgatgat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13909821 |
acatactaggttgtccttgtgtgatgat |
13909848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 51
Target Start/End: Complemental strand, 13890277 - 13890241
Alignment:
| Q |
15 |
acatggttctaagttgcggttgcagttatactacaaa |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
13890277 |
acatggttctaaattgcggttgcagttacactacaaa |
13890241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 51
Target Start/End: Complemental strand, 14030402 - 14030366
Alignment:
| Q |
15 |
acatggttctaagttgcggttgcagttatactacaaa |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
14030402 |
acatggttctaaattgcggttgcagttacactacaaa |
14030366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University