View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2999_high_14 (Length: 211)

Name: NF2999_high_14
Description: NF2999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2999_high_14
NF2999_high_14
[»] chr4 (4 HSPs)
chr4 (1-199)||(33750600-33750804)
chr4 (78-199)||(33735871-33735992)
chr4 (80-198)||(33719203-33719321)
chr4 (93-199)||(33721214-33721326)
[»] chr6 (1 HSPs)
chr6 (119-199)||(32575066-32575146)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 33750600 - 33750804
Alignment:
1 tccaatggttgatgattcacttaagcagtcagaagtggttgctcctgatttagagaatgtaaaagatga------gaatgagaacgagaatatgaatcaa 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||    
33750600 tccaatggttgatgattcacttaagcagtcagaagtggttgctcctgatttagagaatgtaaaagatgagaatgagaatgagaacgagaatatgaatcaa 33750699  T
95 gaaattcaaagtgagacaaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggttta 194  Q
    ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33750700 gaaatgcaaagtgagacaaatattggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggttta 33750799  T
195 tggat 199  Q
    |||||    
33750800 tggat 33750804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 78 - 199
Target Start/End: Original strand, 33735871 - 33735992
Alignment:
78 acgagaatatgaatcaagaaattcaaagtgagacaaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttca 177  Q
    |||||||||||||||||||||| |||| |||||||| ||||||||||| || ||||| | |||||||||||||||||||  | || ||| ||||||||||    
33735871 acgagaatatgaatcaagaaatacaaattgagacaactatgggatttgagagtaataagaattgtgatttttgggatagtatcggagaagctgattttca 33735970  T
178 acaactgatgaggtttatggat 199  Q
    |||||| |||||||||||||||    
33735971 acaactaatgaggtttatggat 33735992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 80 - 198
Target Start/End: Original strand, 33719203 - 33719321
Alignment:
80 gagaatatgaatcaagaaattcaaagtgagacaaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaac 179  Q
    |||||||||||||||||||| |||| ||| ||||  | ||| |||| |||||||| |||||||||||||| ||||||  |||| ||| ||||||||||||    
33719203 gagaatatgaatcaagaaatgcaaattgaaacaatgacggggtttgagaataataaggattgtgattttttggatagcattggtgaacctgattttcaac 33719302  T
180 aactgatgaggtttatgga 198  Q
    || | |||| |||||||||    
33719303 aatttatgaagtttatgga 33719321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 93 - 199
Target Start/End: Original strand, 33721214 - 33721326
Alignment:
93 aagaaattcaaagtgagacaaatatgggatttgggaataatatg---gattgtgatttttgggataggcttggggaaa---ctgattttcaacaactgat 186  Q
    ||||||| |||| ||||||||  ||||||||||||||||||| |   || |||||||||||||||||  ||||||||    |||||||||||||||| ||    
33721214 aagaaatgcaaattgagacaacgatgggatttgggaataatacgactgaatgtgatttttgggatagtattggggaagaagctgattttcaacaacttat 33721313  T
187 gaggtttatggat 199  Q
    |||||||||||||    
33721314 gaggtttatggat 33721326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 199
Target Start/End: Original strand, 32575066 - 32575146
Alignment:
119 ggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggat 199  Q
    |||||| | ||| ||||||||||||| |||||||||| | ||||||||  ||| ||||  ||| | |||||||||||||||    
32575066 ggatttagaaatgatatggattgtgaattttgggatatgattggggaaggtgaatttcggcaagttatgaggtttatggat 32575146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University