View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2999_low_15 (Length: 211)
Name: NF2999_low_15
Description: NF2999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2999_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 33750600 - 33750804
Alignment:
| Q |
1 |
tccaatggttgatgattcacttaagcagtcagaagtggttgctcctgatttagagaatgtaaaagatga------gaatgagaacgagaatatgaatcaa |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33750600 |
tccaatggttgatgattcacttaagcagtcagaagtggttgctcctgatttagagaatgtaaaagatgagaatgagaatgagaacgagaatatgaatcaa |
33750699 |
T |
 |
| Q |
95 |
gaaattcaaagtgagacaaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggttta |
194 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33750700 |
gaaatgcaaagtgagacaaatattggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggttta |
33750799 |
T |
 |
| Q |
195 |
tggat |
199 |
Q |
| |
|
||||| |
|
|
| T |
33750800 |
tggat |
33750804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 78 - 199
Target Start/End: Original strand, 33735871 - 33735992
Alignment:
| Q |
78 |
acgagaatatgaatcaagaaattcaaagtgagacaaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttca |
177 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| ||||||||||| || ||||| | ||||||||||||||||||| | || ||| |||||||||| |
|
|
| T |
33735871 |
acgagaatatgaatcaagaaatacaaattgagacaactatgggatttgagagtaataagaattgtgatttttgggatagtatcggagaagctgattttca |
33735970 |
T |
 |
| Q |
178 |
acaactgatgaggtttatggat |
199 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
33735971 |
acaactaatgaggtttatggat |
33735992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 80 - 198
Target Start/End: Original strand, 33719203 - 33719321
Alignment:
| Q |
80 |
gagaatatgaatcaagaaattcaaagtgagacaaatatgggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaac |
179 |
Q |
| |
|
|||||||||||||||||||| |||| ||| |||| | ||| |||| |||||||| |||||||||||||| |||||| |||| ||| |||||||||||| |
|
|
| T |
33719203 |
gagaatatgaatcaagaaatgcaaattgaaacaatgacggggtttgagaataataaggattgtgattttttggatagcattggtgaacctgattttcaac |
33719302 |
T |
 |
| Q |
180 |
aactgatgaggtttatgga |
198 |
Q |
| |
|
|| | |||| ||||||||| |
|
|
| T |
33719303 |
aatttatgaagtttatgga |
33719321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 93 - 199
Target Start/End: Original strand, 33721214 - 33721326
Alignment:
| Q |
93 |
aagaaattcaaagtgagacaaatatgggatttgggaataatatg---gattgtgatttttgggataggcttggggaaa---ctgattttcaacaactgat |
186 |
Q |
| |
|
||||||| |||| |||||||| ||||||||||||||||||| | || ||||||||||||||||| |||||||| |||||||||||||||| || |
|
|
| T |
33721214 |
aagaaatgcaaattgagacaacgatgggatttgggaataatacgactgaatgtgatttttgggatagtattggggaagaagctgattttcaacaacttat |
33721313 |
T |
 |
| Q |
187 |
gaggtttatggat |
199 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33721314 |
gaggtttatggat |
33721326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 199
Target Start/End: Original strand, 32575066 - 32575146
Alignment:
| Q |
119 |
ggatttgggaataatatggattgtgatttttgggataggcttggggaaactgattttcaacaactgatgaggtttatggat |
199 |
Q |
| |
|
|||||| | ||| ||||||||||||| |||||||||| | |||||||| ||| |||| ||| | ||||||||||||||| |
|
|
| T |
32575066 |
ggatttagaaatgatatggattgtgaattttgggatatgattggggaaggtgaatttcggcaagttatgaggtttatggat |
32575146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University