View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3001_high_13 (Length: 429)
Name: NF3001_high_13
Description: NF3001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3001_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 262 - 413
Target Start/End: Complemental strand, 40057916 - 40057765
Alignment:
| Q |
262 |
aaaaaatcaaacccctctttgattacaaattttgttcgttcgtggcagtcgattatttccatagtttacggttggtggatacatatattagagctctttc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40057916 |
aaaaaatcaaacccctctttgattacaaatttggttcgttcgtggcagtcgattatttccatagtttacggttggtggatacatatattagagctctttc |
40057817 |
T |
|
| Q |
362 |
attttatgtcggtaatttatttccatatttttcgcttggtggacattagaaa |
413 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40057816 |
attttatgtcggtaatttatttccatatttttcgcttggtggacattagaaa |
40057765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 40058179 - 40058006
Alignment:
| Q |
1 |
agactaatttgagttgtaattttatctacgactgaattggatcatnnnnnnnnttcaatgaccaaaatgaatatgtgcctgccatatttgggttctaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40058179 |
agactaatttgagttgtaattttatctacgactgacttggatcataaaaaaaattcaatgacgaaaatgaatatgtgcctgccatatttgggttctaaat |
40058080 |
T |
|
| Q |
101 |
agttccttttacaatatttccctattttgcggttggtgggaaattggcaatgtcaactagaggactacaaccct |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40058079 |
agttccttttacaatatttccctattttgcggttggtgggaaattggcaatgtcaactagaggactacaaccct |
40058006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University