View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3001_high_37 (Length: 238)
Name: NF3001_high_37
Description: NF3001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3001_high_37 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 37308349 - 37308570
Alignment:
| Q |
17 |
attatataaatattatgctgtcggtgtcaacactcgacagcattgctttattcaatccatactaaaatttgatactttatgataaaccttctaaacttga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37308349 |
attatataaatattatgctgtcggtgtcaacactcgacagcattgctttattcaatccgtactaaaatttgatactttatgataaaccttctaaacttga |
37308448 |
T |
|
| Q |
117 |
tttggattttttgtgttctggtgtttatgattttgtttggggtattttggttatcaggagtggagctgcccggaagctggtgaagtattgaaaaagaatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37308449 |
tttggattttttgtgttctggtgtttatgattttgtttggggtattttggttatcaggagtggagctgcccggaagctggtgaagtattgaaaaagaatt |
37308548 |
T |
|
| Q |
217 |
cagtgccggattggccattgct |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37308549 |
cagtgccggattggccattgct |
37308570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University