View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3001_high_4 (Length: 530)
Name: NF3001_high_4
Description: NF3001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3001_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 219 - 514
Target Start/End: Complemental strand, 40473630 - 40473333
Alignment:
| Q |
219 |
gtactagatcgttcttctttttacaaaatttattggatccttttaaacgtatatggattacgtagtaaagtttacgggcaatatgaatatgcttgtgtgt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40473630 |
gtactagatcgttcttctttttacaaaatttattggatccttttaaacgtatatggattacgtagtaaagtttacgggcaatatgaatatgcttgtgtgt |
40473531 |
T |
 |
| Q |
319 |
accgattaatgatgccagttaattaatcaattctgatatttgattgaagttttgcttttgaatgtacctgtaatgaattgaatcatttagttaagtctaa |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40473530 |
accgattaatgatgccagttaattaatcaattctgatatttgattgaagttttgcttttgaatgtacctgtaatgaattgaatcatttagttaagtctaa |
40473431 |
T |
 |
| Q |
419 |
tgaaannnnnnnnnnnnngacatgctaataaaagatatttgtctttagacaattaagtatatgaagg--tagttaggcttcttatgtttagtctctct |
514 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
40473430 |
tgaaagattttattttttgacatgctaataaaagatatttgtctttagacaattaagtatatgagggtatagttaggcctcttatgtttagtctctct |
40473333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 2 - 109
Target Start/End: Complemental strand, 40473835 - 40473728
Alignment:
| Q |
2 |
ccaacttattatgctattattatcatcttcttacaagcaaattattgtttggtaattttgtaagcagaatggcgtatggttggatttcggtaagattgat |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40473835 |
ccaacttattatgctattattatcatctttttacaagcaaattattgtttggtaattttgtaagcagtatggcgtatggttggatttcggtaagattgat |
40473736 |
T |
 |
| Q |
102 |
attcatag |
109 |
Q |
| |
|
|||||||| |
|
|
| T |
40473735 |
attcatag |
40473728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University