View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3001_high_49 (Length: 211)

Name: NF3001_high_49
Description: NF3001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3001_high_49
NF3001_high_49
[»] chr3 (1 HSPs)
chr3 (19-200)||(32617956-32618137)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 32618137 - 32617956
Alignment:
19 gaaaaatgcaaagccatatctactattgttagctgttcaatttggttctgctggtatgttcatttttgccatggatgctatcaagaaaggcatgagccat 118  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32618137 gaaaaatgcaaagccatatctactattgttggctgttcaatttggttctgctggtatgttcatttttgccatggatgctatcaagaaaggcatgagccat 32618038  T
119 tatgttttcatcgtttaccggaatgccatcgctgctgtaacgttagctcccttcgcatttcatctagaaaggtctctgctcc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32618037 tatgttttcatcgtttaccggaatgccatcgctgctgtaacgttagctcccttcgcatttcatctagaaaggtctctgctcc 32617956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University