View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3001_low_27 (Length: 308)
Name: NF3001_low_27
Description: NF3001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3001_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 6 - 287
Target Start/End: Complemental strand, 6117806 - 6117527
Alignment:
| Q |
6 |
atactagtactattattgttgcaattgtaggtcagtattattaattttggttttgtccatggatatgaatttaaaagatgatggattttttggataggcc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6117806 |
atactagtactattattgttgcaattgtaggccagtattattaattttggttttgaccatggatatgaatttaaaagatgatggattttttggataggcc |
6117707 |
T |
|
| Q |
106 |
atatcaaacctagctataaccttctattctacaaggacgattatcactactaacaataataatgttggtaaagatatatgt--tttgaatgcatatgttt |
203 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
6117706 |
atatcaaaccta----taaccttctactctacaaggacgattatcactactaacaataataatgttggtaaagatatatatattttgaatgcatatgttt |
6117611 |
T |
|
| Q |
204 |
ataagtttcttgtatagtcctttaatggcactttagtcaactgcaaatttttctatgtatacaatcgtctacatattgtaaagg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6117610 |
ataagtttcttgtatagtcctttaatggcactttagtcaactgcaaatttttctatgtatacaatcgtctacatattgtaaagg |
6117527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University