View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3001_low_38 (Length: 250)
Name: NF3001_low_38
Description: NF3001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3001_low_38 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 37309170 - 37308932
Alignment:
| Q |
12 |
atgaaaaataacaaaaataaaatagcaagtataagccacctttagattttatattgaaattctagtataaaagacttgtaattaatcatgagcaaacaca |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37309170 |
atgacaaataacaaaaataaaatagcaagtataagccacctttagattttttattgaaattctagtataaaagacttgtaattaatcatgagcaaacaca |
37309071 |
T |
|
| Q |
112 |
cgagatgttttaattttgtcttcacttttgtactatttgaggataggcttatactagtgagatattcacggttttaaataaaagtatgtgaccgtgatct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37309070 |
cgagatgttttaattttgtcttcacttttgtactatttgaggataggcttatactagtgagatattcacggttttaaataaaagtatgtgaccgtgatct |
37308971 |
T |
|
| Q |
212 |
ggccgtgacagaacggtttttgctgttgttgaagctacg |
250 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37308970 |
gcccgtgacagaacggtttttgctgttgttgaagctacg |
37308932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University