View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3001_low_48 (Length: 237)
Name: NF3001_low_48
Description: NF3001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3001_low_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 220
Target Start/End: Complemental strand, 29690097 - 29689895
Alignment:
| Q |
18 |
atatcttactacttatattaattaatttgatagaactcgtatcttactacttattaattaaaattatattgtgaagcataaaatcaatagtgggtcaaat |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29690097 |
atatcttactgcttatattaattaatttgatagaactcgtatcttactacttattaattaaaattatattgtgaagcataaaatcaatagtgggtcaaat |
29689998 |
T |
 |
| Q |
118 |
atcttacttaattattagttaacattaaaatgtggtccacaaaattatgcatgaggaacacaactaaaatatgcacgtcagtcaaacccgcagccctctt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
29689997 |
atcttacttaattattagttaacattaaaatgtggtccacaaaattatgcatgaggaacacaactaaaatatgcacgtcactcaaacccgcagtcctctt |
29689898 |
T |
 |
| Q |
218 |
ttc |
220 |
Q |
| |
|
||| |
|
|
| T |
29689897 |
ttc |
29689895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University