View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_high_119 (Length: 239)
Name: NF3002_high_119
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_high_119 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 38631914 - 38632139
Alignment:
| Q |
17 |
atttcatgatataagtaagcaaacacatgtgatattggcttatgactttggagtgtactcctc---aaaattttaggttcgattatctccgttgtcaaat |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||| ||||||| || ||||||||||||||||||||| | |
|
|
| T |
38631914 |
atttcatgatataagtcagcaaacacatatgatattggcttatgactttgaagtgtactccttcttaaaatttcagattcgattatctccgttgtcaatt |
38632013 |
T |
 |
| Q |
114 |
tagatggactaatatagtttctttcttcttaannnnnnnnnn-gaacaaacacaagtcttaattcaaaaatccaattgtatatgatagtgatattagtgg |
212 |
Q |
| |
|
||||||||||||| || |||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38632014 |
tagatggactaatttaatttctt-cttcttaatttttttttttgaacaaacacaagtcttaattcaaaaatccaattatatatgatagtgatattagtgg |
38632112 |
T |
 |
| Q |
213 |
ttaatttattataatgtcatggaaaat |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38632113 |
ttaatttattataatgtcatggaaaat |
38632139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 136
Target Start/End: Complemental strand, 30584832 - 30584784
Alignment:
| Q |
88 |
aggttcgattatctccgttgtcaaattagatggactaatatagtttctt |
136 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||||| ||||||||| |
|
|
| T |
30584832 |
aggttcgattatctccgatgtcaatttagatgagctaatttagtttctt |
30584784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University