View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_high_125 (Length: 237)
Name: NF3002_high_125
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_high_125 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 6974250 - 6974032
Alignment:
| Q |
3 |
ttatggaaccaatagaccaacgcaaaacacactttgtctttgaaatgcaaaagaaagaccccaacatgtggttcaaatataaagatagttaatgggatat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6974250 |
ttatggaaccaatagaccaacgcaaaacacactttgtctttgaaatgcaaaagaaagacccgaacatgtggttcaaatataaagatagttaatgggatat |
6974151 |
T |
 |
| Q |
103 |
taagctaaatttaatgacactatattgacaagcatattctcattcatatatttgcatgtgttttgaaataatttttcagtgctagctagctcactatata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6974150 |
taagctaaatttaatgacactatattgacaagcatattctcattcatatatttgcatgtgttttgaaataatttttcagtgctagctagctcactatata |
6974051 |
T |
 |
| Q |
203 |
tacacacacgtgtaaaatt |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6974050 |
tacacacacgtgtaaaatt |
6974032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University