View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3002_high_137 (Length: 209)

Name: NF3002_high_137
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3002_high_137
NF3002_high_137
[»] chr2 (1 HSPs)
chr2 (15-196)||(44716560-44716742)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 44716742 - 44716560
Alignment:
15 caaaggtcaatatgtaattatccagtgactaaataatcgacaaactagtccatgaaatgatttaagttttgtagagaattaacgtgtcacataaataaat 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||    
44716742 caaaggtcaatatgtaattatccagtgactaaataatcgacaaactagtccatgaaatgagttaagttttgaagagaattaacgtgtcacataaataaat 44716643  T
115 agaagtaacaaatta-ttttgaaaaaagatttaaatgagttggattcattaggcttactgtcgacagatatcaacgctcaaag 196  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
44716642 agaagtaacaaattatttttgaaaaaagatttaaatgagttggattcattaggcttaccgtcgacagatatcaacgctcaaag 44716560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University