View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_high_67 (Length: 339)
Name: NF3002_high_67
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_high_67 |
 |  |
|
| [»] chr2 (62 HSPs) |
 |  |
|
| [»] chr8 (81 HSPs) |
 |  |
|
| [»] chr6 (51 HSPs) |
 |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |
|
| [»] scaffold0734 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |
|
| [»] scaffold0285 (1 HSPs) |
 |  |  |
|
| [»] scaffold0196 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |
|
| [»] scaffold0037 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 3e-70; HSPs: 78)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 19 - 173
Target Start/End: Original strand, 772348 - 772501
Alignment:
| Q |
19 |
gattgagtttgttagggttttgaaaagagaatacggagaaaaagagaagagtgaagtttgagagtttttcaagtgatgtgaagaaaacaagcgtgaaggg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
772348 |
gattgagtttgttagggttttgaaaagagaatacggagaaaaagagaa-agtgaagtttgagagtttttcaagttatgtgaagaaaacatgcgtgaaggg |
772446 |
T |
 |
| Q |
119 |
ttttgatatatatagtagaaaacatgcacttttggaaacttctagaatctatctt |
173 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
772447 |
ttttgatatatatagtagaaaacatgtacttttggaaacttctagaatctatctt |
772501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 228 - 339
Target Start/End: Complemental strand, 1570330 - 1570222
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttggtgtcatccccgtcagcttagctcaattggtagggat |
327 |
Q |
| |
|
|||||||||||||||| ||||| | | ||| ||||| ||||||||| ||||||| |||| || |||||||| ||||||||||| ||||||||||| |
|
|
| T |
1570330 |
ttactttttcattatcctaattatatcctta---aacaattttttctataataaagattgttgttgatatccccgtgagcttagctcagttggtagggat |
1570234 |
T |
 |
| Q |
328 |
attgcatattat |
339 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1570233 |
attgcatattat |
1570222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 16526250 - 16526207
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattat |
16526207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 3269615 - 3269659
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3269615 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
3269659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 4482672 - 4482628
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4482672 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
4482628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 6702572 - 6702616
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6702572 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
6702616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 8865850 - 8865894
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8865850 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
8865894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 15819675 - 15819631
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15819675 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
15819631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 1151756 - 1151799
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1151756 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
1151799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2556553 - 2556596
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2556553 |
atccccgtaagcttagctcagttggtagggatattgcatattat |
2556596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 5880898 - 5880843
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaa |
282 |
Q |
| |
|
|||||||||||||| || |||||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
5880898 |
tttactttttcattgtcccaattatacccttaaataacaactttttctataataaa |
5880843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 6438137 - 6438094
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6438137 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
6438094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 7166300 - 7166257
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
7166257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 10664867 - 10664824
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
10664824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 19011356 - 19011395
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19011356 |
ccgtgagcttagctcaattggtagggatattgcatattat |
19011395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 21265653 - 21265696
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
21265696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 22563383 - 22563426
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22563383 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
22563426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 25999847 - 25999890
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25999847 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
25999890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 26584819 - 26584776
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26584819 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
26584776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 32594248 - 32594291
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
32594291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 33207202 - 33207245
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
33207245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 33254725 - 33254768
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
33254768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 33274897 - 33274940
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
33274940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 35605696 - 35605653
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35605696 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
35605653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 40519617 - 40519574
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40519617 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
40519574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 42054330 - 42054373
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
42054373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 42490483 - 42490440
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42490483 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
42490440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 46965737 - 46965780
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46965737 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
46965780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 50899583 - 50899540
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
50899540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 335
Target Start/End: Complemental strand, 19276016 - 19275982
Alignment:
| Q |
301 |
cgtcagcttagctcaattggtagggatattgcata |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19276016 |
cgtcagcttagctcaattggtagggatattgcata |
19275982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 228 - 282
Target Start/End: Complemental strand, 44922025 - 44921971
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaa |
282 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| ||||| ||||||||| ||||| |
|
|
| T |
44922025 |
ttactttttcattatctcaattatacccttaaacaacaattttttctataataaa |
44921971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 305 - 339
Target Start/End: Original strand, 51933512 - 51933546
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51933512 |
agcttagctcaattggtagggatattgcatattat |
51933546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 298 - 339
Target Start/End: Original strand, 16343027 - 16343068
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggatattgcatattat |
16343068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 19285545 - 19285488
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||| |||||| ||| ||||| || |||||||||||| ||||||| |
|
|
| T |
19285545 |
tttactttttcattatcccaattatacccttaaacaaaaactttttctataataaaga |
19285488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 307 - 339
Target Start/End: Original strand, 6213429 - 6213461
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6213429 |
cttagctcaattggtagggatattgcatattat |
6213461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 9866254 - 9866214
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggatattgcatattat |
9866214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 12502328 - 12502284
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
12502328 |
catccccgtaagcatagctcagttggtagggatattgcatattat |
12502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 297
Target Start/End: Complemental strand, 14594727 - 14594660
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttggtgtcat |
297 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
14594727 |
tttactttttcattatctcaattatacacttaaa---caactttttctataataaagaatgttggtgtcat |
14594660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 15775739 - 15775779
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
15775739 |
cccgtgagcttaactcaattggtagggatattgcatattat |
15775779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 18551707 - 18551663
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
18551707 |
catccccgtgagcttagctcagttggtatggatattgcatattat |
18551663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 290
Target Start/End: Original strand, 48419967 - 48420026
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
48419967 |
ttactttttcattatcccaattataccatta---aacaactttttctataataaagatcgttg |
48420026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 1836500 - 1836543
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattat |
1836543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 2277755 - 2277794
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatattat |
2277794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2754357 - 2754400
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2754357 |
atccccgtgagcttagcttagttggtagggatattgcatattat |
2754400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 5190854 - 5190811
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5190854 |
atccccatgagcttagctcaattggtagggatatcgcatattat |
5190811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 6130106 - 6130063
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
6130106 |
atccccgtgagcgtagctcagttggtagggatattgcatattat |
6130063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 6893310 - 6893267
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
6893310 |
atccccgtgagcttagctcagttggtagggatattgcattttat |
6893267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 292 - 339
Target Start/End: Original strand, 8415722 - 8415769
Alignment:
| Q |
292 |
tgtcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
8415722 |
tgtcatccacgtgagcttagctcagttcgtagggatattgcatattat |
8415769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 11215002 - 11215041
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatattat |
11215041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 12404353 - 12404396
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||| ||||||||||||||||||||||||||| |
|
|
| T |
12404353 |
atccccgtgagattagatcaattggtagggatattgcatattat |
12404396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 13773165 - 13773208
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
13773165 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
13773208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 18467271 - 18467228
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
18467271 |
atccccgtgagcatagctcagttggtagggatattgcatattat |
18467228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 34058215 - 34058254
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatattgcatattat |
34058254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 37662630 - 37662587
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37662630 |
atcctcgtgagcttagctcagttggtagggatattgcatattat |
37662587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 40375388 - 40375345
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
40375388 |
atccccgtgagcatagctcagttggtagggatattgcatattat |
40375345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 40520827 - 40520870
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
40520870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 299 - 338
Target Start/End: Complemental strand, 42550079 - 42550040
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
42550079 |
cccgtgagcttagctcaatcggtagggatattgcatatta |
42550040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 43884791 - 43884834
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
43884791 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
43884834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 44732630 - 44732673
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
44732630 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
44732673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 47402736 - 47402693
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
47402736 |
atccccgtgagcttagctcagctggtagggatattgcatattat |
47402693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 48638529 - 48638572
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
48638529 |
atccccgtgagcttagctcagttggtagggatattgcattttat |
48638572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 51050187 - 51050230
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattat |
51050230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 290
Target Start/End: Original strand, 773721 - 773783
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
|||||||||||||||| |||||| ||| ||||| || || ||||||||| |||||||| |||| |
|
|
| T |
773721 |
ttactttttcattatcccaattatacccttaaacaataattttttctataataaagactgttg |
773783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Original strand, 27818575 - 27818609
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27818575 |
agcttagctcagttggtagggatattgcatattat |
27818609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 43677781 - 43677823
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
43677781 |
catccccgtcagcttagcccggttggtagggatattgcatatt |
43677823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 293 - 339
Target Start/End: Complemental strand, 47478924 - 47478878
Alignment:
| Q |
293 |
gtcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| ||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
47478924 |
gtcatcctcgtgagcttaactcagttggtagggatattgcatattat |
47478878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 52043356 - 52043409
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| |
|
|
| T |
52043356 |
ttactttttcattatctcaattataccttta---aacaactttttctataataaaga |
52043409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 329
Target Start/End: Original strand, 2876431 - 2876464
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatat |
329 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
2876431 |
atccccgtgagcttagctcaattggtagggatat |
2876464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 337
Target Start/End: Original strand, 18216903 - 18216944
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
18216903 |
atccccgtgagcttagctcagttggtagggatattacatatt |
18216944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 329
Target Start/End: Complemental strand, 18893329 - 18893296
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatat |
329 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
18893329 |
atccccgtcagcttagctcagttggtagggatat |
18893296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 290
Target Start/End: Original strand, 25298030 - 25298090
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||| ||||| ||||||||| ||||||| ||||| |
|
|
| T |
25298030 |
tttactttttcattatctcaattataccttta---aacaaatttttctataataaagatcgttg |
25298090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 52426988 - 52426943
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
52426988 |
tcatctccgtgagcttagctcagttgatagggatattgcatattat |
52426943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 307 - 339
Target Start/End: Original strand, 24253780 - 24253812
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
24253780 |
cttagctcatttggtagggatattgcatattat |
24253812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 335
Target Start/End: Original strand, 24874971 - 24875007
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcata |
335 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
24874971 |
cccgtgagcttagctcagttggtagggatattgcata |
24875007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 32556999 - 32556959
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
32556999 |
cccgtgagcttagctcagctggtagggatattgcatattat |
32556959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 282
Target Start/End: Complemental strand, 33934258 - 33934207
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaa |
282 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||| |
|
|
| T |
33934258 |
ttactttttcattatctcaattataccctta---aacaactttttctataataaa |
33934207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 296 - 336
Target Start/End: Complemental strand, 45333784 - 45333744
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatat |
336 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||||||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcatat |
45333744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 50943984 - 50943928
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || |||||||| ||| ||||||| |
|
|
| T |
50943984 |
ttacttttttattatctcaattatacccttaaacaaaaactttttttataataaaga |
50943928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 55)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 42207807 - 42207863
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||| ||||||| |
|
|
| T |
42207807 |
ttactttttcattatctcaattataccattaaataacaactttttttataataaaga |
42207863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 6558798 - 6558841
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6558798 |
atccccgtgagcttagctcaattggtagggatattgcatattat |
6558841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 293 - 339
Target Start/End: Original strand, 32505682 - 32505728
Alignment:
| Q |
293 |
gtcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32505682 |
gtcatccccgtgagcttagctcagttggtagggatattgcatattat |
32505728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 1269241 - 1269197
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1269241 |
catccccgtgagcttagctcaattggtagagatattgcatattat |
1269197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 6518850 - 6518806
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6518850 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
6518806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 12463752 - 12463796
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12463752 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
12463796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 41179877 - 41179833
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41179877 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
41179833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 1743124 - 1743167
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1743124 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
1743167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 4417758 - 4417715
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4417758 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
4417715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 9835030 - 9835073
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
9835073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 11897245 - 11897288
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11897245 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
11897288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 12891554 - 12891597
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12891554 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
12891597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 16603395 - 16603438
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16603395 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
16603438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 17545245 - 17545202
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17545245 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
17545202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 21918049 - 21918092
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
21918092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 26912830 - 26912873
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattat |
26912873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 27765254 - 27765297
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27765254 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
27765297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 42320314 - 42320357
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42320314 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
42320357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 338
Target Start/End: Complemental strand, 25648158 - 25648116
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
25648158 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
25648116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 298 - 339
Target Start/End: Complemental strand, 4745947 - 4745906
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggatattgcatattat |
4745906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 298 - 339
Target Start/End: Complemental strand, 25472654 - 25472613
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggatattgcatattat |
25472613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 36888470 - 36888425
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
36888470 |
tcatccccgtgagcttagttcagttggtagggatattgcatattat |
36888425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 5900288 - 5900332
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
5900288 |
catccccgtgagcttaactcagttggtagggatattgcatattat |
5900332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 14641179 - 14641139
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
14641179 |
cccgtgagcttaactcaattggtagggatattgcatattat |
14641139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 335
Target Start/End: Complemental strand, 18049691 - 18049655
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcata |
335 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18049691 |
cccgtgagcttagctcaattggtagggatattgcata |
18049655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 35515512 - 35515552
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35515512 |
cccgtgagcttagctcagttggtagggatattgcatattat |
35515552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2328589 - 2328632
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattat |
2328632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2848210 - 2848253
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
2848210 |
atccccgtgagcttagctcagttggtagggatattgtatattat |
2848253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 5966826 - 5966869
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattat |
5966869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 8241047 - 8241090
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8241047 |
atccccatgagcttagctcagttggtagggatattgcatattat |
8241090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 8968750 - 8968789
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8968750 |
ccgtgagcttagctcagttggtagggatattgcatattat |
8968789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 9125660 - 9125703
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
9125660 |
atccccgtgagcttagctcagttggtagcgatattgcatattat |
9125703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 12767961 - 12768004
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatattat |
12768004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 13622019 - 13621976
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
13622019 |
atccccgtgagcttagctcagttggtagggatatcgcatattat |
13621976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 17064931 - 17064888
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
17064931 |
atcctcgtgagcttaactcaattggtagggatattgcatattat |
17064888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 18815345 - 18815388
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattat |
18815388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 21749450 - 21749407
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattat |
21749407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 29713449 - 29713406
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggatattgcctattat |
29713406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 32706319 - 32706362
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattat |
32706362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 39886285 - 39886242
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
39886285 |
atccccgtgagcatagctcagttggtagggatattgcatattat |
39886242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 39919166 - 39919123
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
39919166 |
atccccgtgagcttagcttagttggtagggatattgcatattat |
39919123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 40091474 - 40091517
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
40091517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 42525397 - 42525440
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
42525440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 16386805 - 16386771
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16386805 |
agcttagctcagttggtagggatattgcatattat |
16386771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 36226446 - 36226499
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| |
|
|
| T |
36226446 |
ttactttttcattatctcaattataccctta---aacaactttttctataataaaga |
36226499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 22569319 - 22569274
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| || ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
22569319 |
tcatccctgtgagcttagctcagttggtaggcatattgcatattat |
22569274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 7649147 - 7649091
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||| |||||| |||| | ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
7649147 |
ttacttttttattatcccaatcatacccttaaacaacaactttttctataataaaga |
7649091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 15241392 - 15241436
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
15241392 |
catccccgtgagcttagctcagttgataggaatattgcatattat |
15241436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 17666006 - 17666046
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
17666006 |
cccgtgagcttagctcagttggtaggaatattgcatattat |
17666046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 272
Target Start/End: Original strand, 23270439 - 23270483
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaacttttt |
272 |
Q |
| |
|
|||||||||||||||| |||||| ||| ||||| ||||||||||| |
|
|
| T |
23270439 |
ttactttttcattatcccaattatacccttaaacaacaacttttt |
23270483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 23292487 - 23292447
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
23292487 |
cccgtgagcttagctcagttggtagggatattgcatgttat |
23292447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 232 - 290
Target Start/End: Complemental strand, 28867671 - 28867616
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||||| ||||||| ||||| |
|
|
| T |
28867671 |
tttttcattatctcaattatacccttaaa---caactttttctataataaagatcgttg |
28867616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 290
Target Start/End: Complemental strand, 42027739 - 42027680
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
||||||||||||||||||||||| || ||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
42027739 |
ttactttttcattatctcaattatactctta---aacaattttttctataataaagaccgttg |
42027680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 304 - 336
Target Start/End: Original strand, 42317404 - 42317436
Alignment:
| Q |
304 |
cagcttagctcaattggtagggatattgcatat |
336 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
42317404 |
cagcttagctcagttggtagggatattgcatat |
42317436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 307 - 339
Target Start/End: Original strand, 43580886 - 43580918
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
43580886 |
cttagctcagttggtagggatattgcatattat |
43580918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 54)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 228 - 293
Target Start/End: Original strand, 5800726 - 5800791
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttggtg |
293 |
Q |
| |
|
|||||||||||||||| |||||| ||| ||||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
5800726 |
ttactttttcattatcccaattatacccttaaataacaattttttctataataaagatcgttggtg |
5800791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 12640663 - 12640619
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12640663 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
12640619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2228972 - 2229015
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
2229015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2681093 - 2681136
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2681093 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
2681136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 9877340 - 9877297
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9877340 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
9877297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 10244962 - 10244919
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10244962 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
10244919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 15238886 - 15238929
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15238886 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
15238929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 19753041 - 19752998
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19753041 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
19752998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 23102631 - 23102588
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
23102588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 25833552 - 25833595
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
25833595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 29617402 - 29617445
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29617402 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
29617445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 35950125 - 35950168
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35950125 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
35950168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 36622171 - 36622214
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
36622171 |
atccccgtgaacttagctcaattggtagggatattgcatattat |
36622214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 37300172 - 37300129
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
37300129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 42443686 - 42443729
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
42443729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 44616599 - 44616642
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44616599 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
44616642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 47641042 - 47641085
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47641042 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
47641085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 47999777 - 47999820
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
47999820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 21066881 - 21066926
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
21066881 |
tcatccccgtgagtttagctcagttggtagggatattgcatattat |
21066926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 296 - 337
Target Start/End: Complemental strand, 23755087 - 23755046
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
23755087 |
atccccgtgagcttagctcaatcggtagggatattgcatatt |
23755046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 284
Target Start/End: Original strand, 48109601 - 48109658
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||| ||||||||||||||||||| | | ||||||||||||||||||| | ||||||| |
|
|
| T |
48109601 |
tttattttttcattatctcaattatatctttaaataacaactttttctgtaataaaga |
48109658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 12772111 - 12772155
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12772111 |
catcctcgtgagcttagctcagttggtagggatattgcatattat |
12772155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 24781030 - 24781070
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggatattgcatattat |
24781070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 276
Target Start/End: Original strand, 25489826 - 25489874
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctat |
276 |
Q |
| |
|
||||||||||||||||| ||||| ||| ||||| ||||||||||||||| |
|
|
| T |
25489826 |
ttactttttcattatcttaattatacctttaaacaacaactttttctat |
25489874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 27510327 - 27510287
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27510327 |
cccgtgagcttagctcagttggtagggatattgcatattat |
27510287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 291 - 339
Target Start/End: Original strand, 30940763 - 30940811
Alignment:
| Q |
291 |
gtgtcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
30940763 |
gtgttatccccgtgagcttagctcagttggtagtgatattgcatattat |
30940811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 36391974 - 36391934
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatattat |
36391934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 38889567 - 38889523
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
38889567 |
catccccgtgagcttaactcagttggtagggatattgcatattat |
38889523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 41465834 - 41465874
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41465834 |
cccgtaagcttagctcagttggtagggatattgcatattat |
41465874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 3766808 - 3766851
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
3766851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 5990218 - 5990175
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
5990218 |
atccccgtgagcttagctcagttggtagggatattgtatattat |
5990175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 308 - 339
Target Start/End: Original strand, 9497975 - 9498006
Alignment:
| Q |
308 |
ttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9497975 |
ttagctcaattggtagggatattgcatattat |
9498006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 9929977 - 9929934
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
9929977 |
atccccgttagcttagctcagttggtagggatattgaatattat |
9929934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 24061402 - 24061359
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
24061402 |
atccccgtgagcttagctcagttggtaggaatattgcatattat |
24061359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 27424836 - 27424879
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattat |
27424879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 30806112 - 30806155
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
30806155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 31026216 - 31026259
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattat |
31026259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 36174391 - 36174430
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcatattat |
36174430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 41084040 - 41084079
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41084040 |
ccgtgagcttagctcagttggtagggatattgcatattat |
41084079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 46534821 - 46534778
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46534821 |
atccccatgagcttagctcagttggtagggatattgcatattat |
46534778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Original strand, 15655710 - 15655744
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
15655710 |
agcttagctcaattggtagggatattgcattttat |
15655744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 30388571 - 30388537
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30388571 |
agcttagctcagttggtagggatattgcatattat |
30388537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 32677006 - 32676972
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32677006 |
agcttagctcagttggtagggatattgcatattat |
32676972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 32984281 - 32984247
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32984281 |
agcttagctcagttggtagggatattgcatattat |
32984247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 35612631 - 35612597
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
35612631 |
agcttagctcaattggtagggagattgcatattat |
35612597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 296 - 338
Target Start/End: Complemental strand, 36469778 - 36469736
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
36469778 |
atccccgtgagcttagctcagttggtagggatattacatatta |
36469736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Original strand, 36720113 - 36720147
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36720113 |
agcttagctcagttggtagggatattgcatattat |
36720147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 337
Target Start/End: Original strand, 24692472 - 24692513
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
24692472 |
atccccgtgaggttagctcagttggtagggatattgcatatt |
24692513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 18223787 - 18223747
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
18223787 |
cccgtgagcttaactcagttggtagggatattgcatattat |
18223747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 272
Target Start/End: Complemental strand, 21766301 - 21766257
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaacttttt |
272 |
Q |
| |
|
|||||||||||||||| |||||| ||| ||||| ||||||||||| |
|
|
| T |
21766301 |
ttactttttcattatcccaattatacccttaaacaacaacttttt |
21766257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 24062081 - 24062041
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
24062081 |
cccgtgagcttagctcagttagtagggatattgcatattat |
24062041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 307 - 339
Target Start/End: Complemental strand, 32856979 - 32856947
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
32856979 |
cttagcttaattggtagggatattgcatattat |
32856947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 33996955 - 33996911
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
33996955 |
catccccgtgagtatagctcagttggtagggatattgcatattat |
33996911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 34267621 - 34267581
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
34267621 |
cccgtgagcttagctcagttggtaggaatattgcatattat |
34267581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 82)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 25012682 - 25012626
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
25012682 |
ttactttttcattatctcaattatacccttaaacaacaactttttctataataaaga |
25012626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 19999863 - 19999907
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19999863 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
19999907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 28550393 - 28550349
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28550393 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
28550349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 31327575 - 31327531
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31327575 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
31327531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 31327792 - 31327748
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31327792 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
31327748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 40548299 - 40548343
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40548299 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
40548343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 41936481 - 41936437
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41936481 |
catccccgtaagcttagctcagttggtagggatattgcatattat |
41936437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 52410315 - 52410271
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52410315 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
52410271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 52945891 - 52945935
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52945891 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
52945935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 882386 - 882429
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
882386 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
882429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2522923 - 2522966
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2522923 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
2522966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 6488121 - 6488164
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6488121 |
atccccatgagcttagctcaattggtagggatattgcatattat |
6488164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 7269952 - 7269995
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
7269995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 7920317 - 7920360
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
7920360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 19550503 - 19550546
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19550503 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
19550546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 22502004 - 22501961
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
22501961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 33706800 - 33706757
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
33706800 |
atccccgtgagcttagctcaattggtagggatattacatattat |
33706757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 37800684 - 37800641
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37800684 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
37800641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 39966147 - 39966104
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
39966104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 40192153 - 40192196
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40192153 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
40192196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 40933904 - 40933861
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40933904 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
40933861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 44652055 - 44652012
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44652055 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
44652012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 45701341 - 45701384
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45701341 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45701384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 228 - 297
Target Start/End: Complemental strand, 49429765 - 49429699
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttggtgtcat |
297 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
49429765 |
ttactttttcattatctcaattataccctta---aacaactttttctataataaagattgttggtgtcat |
49429699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 50496887 - 50496844
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50496887 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
50496844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 53163591 - 53163634
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
53163634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 53347363 - 53347320
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53347363 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
53347320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 338
Target Start/End: Complemental strand, 30555300 - 30555258
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
30555300 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
30555258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 298 - 339
Target Start/End: Complemental strand, 6920034 - 6919993
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggatattgcatattat |
6919993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 50536907 - 50536862
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
50536907 |
tcatccccgtgagcttagctcagttggtagagatattgcatattat |
50536862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 52974128 - 52974083
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
52974128 |
tcatccccgtgagcttaactcagttggtagggatattgcatattat |
52974083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 4139000 - 4139040
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggatattgcatattat |
4139040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 9176656 - 9176616
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggatattgcatattat |
9176616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 26942753 - 26942793
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26942753 |
cccgtaagcttagctcagttggtagggatattgcatattat |
26942793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 290
Target Start/End: Complemental strand, 30102634 - 30102575
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
30102634 |
ttactttttcattatctcaattataccctta---aacaactttttctataataaagatcgttg |
30102575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 31586943 - 31586987
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31586943 |
catccccatgagcttagctcagttggtagggatattgcatattat |
31586987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 47098732 - 47098772
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggatattgcatattat |
47098772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 1743870 - 1743827
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||| |||| |
|
|
| T |
1743870 |
atccccgtgagcttaactcaattggtagggatattgcattttat |
1743827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 3748675 - 3748632
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattat |
3748632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 10176976 - 10176933
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattat |
10176933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 10482926 - 10482883
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
10482926 |
atccccgtgaacttagctcagttggtagggatattgcatattat |
10482883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 11820001 - 11820044
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcatgttat |
11820044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 15975149 - 15975192
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15975149 |
atccctgtgagcttagctcagttggtagggatattgcatattat |
15975192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 17218485 - 17218528
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17218485 |
atccccatgagcttagctcagttggtagggatattgcatattat |
17218528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 18194335 - 18194378
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
18194335 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
18194378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 19996525 - 19996482
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattat |
19996482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 25939003 - 25938960
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
25939003 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
25938960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 28689745 - 28689702
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
28689745 |
atccccgtgaacttagctcagttggtagggatattgcatattat |
28689702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 30779640 - 30779597
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30779640 |
atcctcgtgagcttagctcagttggtagggatattgcatattat |
30779597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 31529031 - 31528988
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattat |
31528988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 32256627 - 32256584
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
32256627 |
atccccgtgagcttagctcagttggtagggatattgcatgttat |
32256584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 34102684 - 34102641
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattat |
34102641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 34898840 - 34898797
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
34898840 |
atccccgtgagcttagttcagttggtagggatattgcatattat |
34898797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 228 - 297
Target Start/End: Complemental strand, 39904003 - 39903937
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttggtgtcat |
297 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||| ||||||| ||||||| ||||||||||| |
|
|
| T |
39904003 |
ttactttttcattatctcaattataccctta---aacaactctttctataataaagattgttggtgtcat |
39903937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 46796002 - 46795959
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
46796002 |
atccccgtgagcttagctcagttggtagggatattgcattttat |
46795959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 48739817 - 48739774
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
48739817 |
atccccgtgagcttagctcagttggtagggatattgcattttat |
48739774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 4640544 - 4640510
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattat |
4640510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 5636863 - 5636829
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5636863 |
agcttagctcagttggtagggatattgcatattat |
5636829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Original strand, 8125645 - 8125679
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8125645 |
agcttagctcagttggtagggatattgcatattat |
8125679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 17602740 - 17602706
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17602740 |
agcttagctcagttggtagggatattgcatattat |
17602706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 230 - 276
Target Start/End: Original strand, 19559258 - 19559304
Alignment:
| Q |
230 |
actttttcattatctcaattacaccattaaataacaactttttctat |
276 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
19559258 |
actttttcattatctcaattatacccttaaacaacaattttttctat |
19559304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 21824516 - 21824463
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| |
|
|
| T |
21824516 |
ttactttttcattatctcaattataccctta---aacaactttttctataataaaga |
21824463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 36625235 - 36625201
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36625235 |
agcttagctcagttggtagggatattgcatattat |
36625201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 270
Target Start/End: Original strand, 41923308 - 41923350
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaacttt |
270 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
41923308 |
ttactttttcattatctcaattatacccttaaacaacaacttt |
41923350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 10349401 - 10349442
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatat |
336 |
Q |
| |
|
||||||||| ||||||||||| ||| |||||||||||||||| |
|
|
| T |
10349401 |
catccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 284
Target Start/End: Original strand, 15293752 - 15293804
Alignment:
| Q |
229 |
tactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
15293752 |
tacttttttattatctcaattacaccctta---aacaactttttatatgataaaga |
15293804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 33225423 - 33225378
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||| |||| |
|
|
| T |
33225423 |
tcatccccgtgagcttagctcagttggtagggatatcgcattttat |
33225378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 336
Target Start/End: Original strand, 34757529 - 34757566
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatat |
336 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
34757529 |
cccgtgagcttagctcagttggtagggatattgcatat |
34757566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 339
Target Start/End: Original strand, 50234123 - 50234164
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
50234123 |
ccccgtgagcttacctcagttggtagggatattgcatattat |
50234164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 52046460 - 52046415
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
52046460 |
tcattcccgtgagcttagctcagttggtagggatattgcattttat |
52046415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 296 - 336
Target Start/End: Complemental strand, 8964849 - 8964809
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatat |
336 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||| |
|
|
| T |
8964849 |
atccccgtgagtttagctcagttggtagggatattgcatat |
8964809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 307 - 339
Target Start/End: Complemental strand, 11250653 - 11250621
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
11250653 |
cttagctcagttggtagggatattgcatattat |
11250621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 232 - 272
Target Start/End: Original strand, 31741156 - 31741196
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaacttttt |
272 |
Q |
| |
|
||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
31741156 |
tttttcattatctcaattatacccttaaacaacaacttttt |
31741196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 32828441 - 32828481
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
32828441 |
cccgtgagcttagctcggttggtagggatattgcatattat |
32828481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 307 - 339
Target Start/End: Complemental strand, 33607001 - 33606969
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
33607001 |
cttagctcaattggtagggatattgcattttat |
33606969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 39719935 - 39719975
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
39719935 |
cccgtgagtttagctcagttggtagggatattgcatattat |
39719975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 44685242 - 44685198
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
44685242 |
catccccgtgagcttagcttagttggtagagatattgcatattat |
44685198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 48546173 - 48546213
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
48546173 |
cccgtgagcttagctcagttggtagtgatattgcatattat |
48546213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 52670223 - 52670183
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
52670223 |
cccgtgagcttagttcagttggtagggatattgcatattat |
52670183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 305 - 337
Target Start/End: Original strand, 52984016 - 52984048
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
52984016 |
agcttagctcagttggtagggatattgcatatt |
52984048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 54349910 - 54349870
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||| |||| ||||||||||||||||||||||||| |
|
|
| T |
54349910 |
cccgtaagctcagcttaattggtagggatattgcatattat |
54349870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 54769904 - 54769860
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| |||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
54769904 |
catctccgtgagcttagcttagttggtagggatattgcatattat |
54769860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 62)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 15233410 - 15233453
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatattat |
15233453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 17034732 - 17034775
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17034732 |
atccccgtgagcttagctcaattggtagggatattgcatattat |
17034775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 228 - 282
Target Start/End: Complemental strand, 9415140 - 9415086
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaa |
282 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| ||||||||||||||| ||||| |
|
|
| T |
9415140 |
ttactttttcattatctcaattatacccttaaacaacaactttttctataataaa |
9415086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 38400305 - 38400350
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38400305 |
tcatccccgtgagcttagctcagttggtagggatattgcatattat |
38400350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 19684069 - 19684113
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19684069 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
19684113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 27913539 - 27913499
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27913539 |
cccgtgagcttagctcaattggtagggatattgcatattat |
27913499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 1844814 - 1844857
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1844814 |
atccccgtaagcttagctcagttggtagggatattgcatattat |
1844857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 3446727 - 3446770
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3446727 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
3446770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 4183173 - 4183216
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
4183216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 8250374 - 8250331
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8250374 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
8250331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 18694782 - 18694825
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18694782 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
18694825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 19281605 - 19281648
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19281605 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
19281648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 22653717 - 22653674
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22653717 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
22653674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 25857368 - 25857325
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25857368 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
25857325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 294 - 337
Target Start/End: Original strand, 27297170 - 27297213
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27297170 |
tcatccccgtgagcttagctcagttggtagggatattgcatatt |
27297213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 33229006 - 33228963
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33229006 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
33228963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 44948593 - 44948636
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44948593 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
44948636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 230 - 284
Target Start/End: Original strand, 18072353 - 18072407
Alignment:
| Q |
230 |
actttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||| ||| |||| ||||||||||||||| ||||||| |
|
|
| T |
18072353 |
actttttcattatctcaattatacccttaagcaacaactttttctataataaaga |
18072407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 1260180 - 1260225
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
1260180 |
tcatccccgtgagcttagctcagttggtagggatattgcatgttat |
1260225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 15764925 - 15764970
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15764925 |
tcatcctcgtgagcttagctcagttggtagggatattgcatattat |
15764970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 298 - 339
Target Start/End: Original strand, 34613978 - 34614019
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggatattgcatattat |
34614019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 5062293 - 5062337
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
5062293 |
catccccgtgagcttaactcagttggtagggatattgcatattat |
5062337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 18278491 - 18278447
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
18278491 |
catccccgtgagtttagctcagttggtagggatattgcatattat |
18278447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 276
Target Start/End: Complemental strand, 33134135 - 33134087
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctat |
276 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
33134135 |
ttactttttcattatctcaattatacccttaaacaacaaatttttctat |
33134087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 36080203 - 36080259
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||||||||||||||| |||||| ||| ||||| ||||| ||||||||| ||||||| |
|
|
| T |
36080203 |
ttactttttcattatcccaattatacccttaaacaacaattttttctataataaaga |
36080259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 284
Target Start/End: Complemental strand, 38702329 - 38702277
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||||| |||||||||||| ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
38702329 |
tttttctttatctcaattatacctttaaacaacaactttttctataataaaga |
38702277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2289607 - 2289650
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
2289607 |
atccccgtgagcttagctcagttggtaggaatattgcatattat |
2289650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2643694 - 2643737
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2643694 |
atccccgtgagcatagctcagttggtagggatattgcatattat |
2643737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 3438945 - 3438988
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
3438945 |
atccccgtgagcgtagctcagttggtagggatattgcatattat |
3438988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 4562825 - 4562782
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
4562825 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
4562782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 5474903 - 5474946
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
5474903 |
atccccgtgagcttagctcagttggcagggatattgcatattat |
5474946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 5521293 - 5521250
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
5521293 |
atccccgtgagcttagctcagttgatagggatattgcatattat |
5521250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 6331559 - 6331602
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
6331559 |
atccccgtgagcatagctcagttggtagggatattgcatattat |
6331602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 7907616 - 7907573
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||| | ||||||||||||||||||||||||| |
|
|
| T |
7907616 |
atccccgtgagcttagtttaattggtagggatattgcatattat |
7907573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 8763379 - 8763422
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
8763379 |
atccccgtgagcttagctcaattcgtagggatattgcattttat |
8763422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 11050830 - 11050787
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
11050830 |
atccccgtgagcttagctcagttggtagggatattacatattat |
11050787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 15485659 - 15485702
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
15485659 |
atccccgtgagcttagctcagttggtaaggatattgcatattat |
15485702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 17078454 - 17078497
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
17078454 |
atccccgtgagcttagctcagttggtagggatattgtatattat |
17078497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 18803208 - 18803251
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
18803208 |
atccccgtgagcttagctcacttggtaggaatattgcatattat |
18803251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 288 - 339
Target Start/End: Original strand, 28194621 - 28194672
Alignment:
| Q |
288 |
ttggtgtcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||||||| | ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
28194621 |
ttggtttcatccccatgagcttagctcagttgctagggatattgcatattat |
28194672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 28195207 - 28195164
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28195207 |
atcctcgtgagcttagctcagttggtagggatattgcatattat |
28195164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 30932519 - 30932476
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30932519 |
atccccgtgagcttacctcagttggtagggatattgcatattat |
30932476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 33233295 - 33233252
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattat |
33233252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 36005439 - 36005482
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
36005439 |
atccccgtgagcgtaactcaattggtagggatattgcatattat |
36005482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 39408763 - 39408720
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
39408763 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
39408720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 40535522 - 40535479
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
40535522 |
atccccgtgagcttagctcagttggtacggatattgcatattat |
40535479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 41509517 - 41509556
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcatattat |
41509556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 44857307 - 44857264
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44857307 |
atcctcgtgagcttagctcagttggtagggatattgcatattat |
44857264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 6636031 - 6635997
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6636031 |
agcttagctcagttggtagggatattgcatattat |
6635997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 30392896 - 30392862
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30392896 |
agcttagctcagttggtagggatattgcatattat |
30392862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Original strand, 36182648 - 36182682
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36182648 |
agcttagctcagttggtagggatattgcatattat |
36182682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 297 - 339
Target Start/End: Original strand, 41566760 - 41566802
Alignment:
| Q |
297 |
tccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| ||||||||||| |||||||| |||||||||||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattat |
41566802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 1397046 - 1397103
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaa-ctttttctatgataaaga |
284 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||| ||||| ||||||||||||||||| |
|
|
| T |
1397046 |
ttactttttcattatcccaattatatcattaaaaaacaatttttttctatgataaaga |
1397103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 7379675 - 7379630
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| |||||| |||| |||||| |||||||||||||||| |
|
|
| T |
7379675 |
tcatccccgtgagcttaactcagttggtaaggatattgcatattat |
7379630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 20296413 - 20296458
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||| || |||||||||||||||| |
|
|
| T |
20296413 |
tcatccccgtgagcttagctcagttgataaggatattgcatattat |
20296458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 40497681 - 40497624
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||| |||||||||||| |||||| ||| ||||| ||| ||||||||||| ||||||| |
|
|
| T |
40497681 |
tttaatttttcattatcccaattatacccttaaagaaccactttttctataataaaga |
40497624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 2806571 - 2806531
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
2806571 |
cccgtgagcttagctcagttggtagggatattgtatattat |
2806531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 3287130 - 3287086
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| || ||||||||||| |||| |||||||||||||||||| |
|
|
| T |
3287130 |
catccctgtgagcttagctcagttggaagggatattgcatattat |
3287086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 3301811 - 3301851
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
3301811 |
cccgtgagcttagctcatttggtagggatattgcattttat |
3301851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 307 - 339
Target Start/End: Original strand, 17487712 - 17487744
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
17487712 |
cttagctcagttggtagggatattgcatattat |
17487744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 19612715 - 19612755
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19612715 |
cccgtgagcttagttcagttggtagggatattgcatattat |
19612755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 38692530 - 38692586
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||| |||||||||| |||||| ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
38692530 |
ttacattttcattattccaattatacccttaaacaacaactttttctataataaaga |
38692586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 81)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 35939482 - 35939527
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35939482 |
tcatccccgtgagcttagctcagttggtagggatattgcatattat |
35939527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 288 - 339
Target Start/End: Original strand, 26022235 - 26022287
Alignment:
| Q |
288 |
ttggtgtca-tccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26022235 |
ttggtgtcaatccccgtgagcttagctcagttggtagggatattgcatattat |
26022287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 44340419 - 44340375
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44340419 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
44340375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 12298 - 12255
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12298 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
12255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 94584 - 94541
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
94584 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
94541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 1937307 - 1937350
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1937307 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
1937350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2590146 - 2590189
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
2590146 |
atccccgtgagcttagctcaattagtagggatattgcatattat |
2590189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 8265265 - 8265308
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8265265 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
8265308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 10736947 - 10736904
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
10736904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 11875883 - 11875926
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
11875926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 11890890 - 11890933
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
11890933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 16449122 - 16449165
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
16449165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 17027953 - 17027910
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17027953 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
17027910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 17558389 - 17558346
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17558389 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
17558346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 17698519 - 17698562
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17698519 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
17698562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 29716857 - 29716900
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
29716900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 30972890 - 30972847
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30972890 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
30972847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 32719680 - 32719637
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
32719637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 34413059 - 34413102
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
34413102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 34894366 - 34894409
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34894366 |
atccccgtaagcttagctcagttggtagggatattgcatattat |
34894409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 39362262 - 39362305
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39362262 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
39362305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 41689879 - 41689922
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41689879 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
41689922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 43656033 - 43656076
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43656033 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
43656076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 339
Target Start/End: Complemental strand, 23178963 - 23178921
Alignment:
| Q |
297 |
tccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattat |
23178921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 338
Target Start/End: Original strand, 28909462 - 28909504
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
28909504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 284
Target Start/End: Original strand, 12838535 - 12838592
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||| ||||| ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
12838535 |
tttactttttcattatcctaattatacccttaaacaacaactttttctataataaaga |
12838592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 20285842 - 20285785
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||| |||||| ||| ||||| ||||| ||||||||| ||||||| |
|
|
| T |
20285842 |
tttactttttcattatcacaattatacccttaaacaacaattttttctataataaaga |
20285785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 21072471 - 21072414
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||| |||||| ||| ||||| ||||| ||||||||| ||||||| |
|
|
| T |
21072471 |
tttactttttcattatcacaattatacccttaaacaacaattttttctataataaaga |
21072414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 23858192 - 23858237
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23858192 |
tcatctccgtgagcttagctcagttggtagggatattgcatattat |
23858237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 296 - 337
Target Start/End: Complemental strand, 38745352 - 38745311
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38745352 |
atccccgtgagcttagctcagttggtagggatattgcatatt |
38745311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 6280476 - 6280520
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
6280476 |
catccccgtgagcttagctcagttggtagggatattgaatattat |
6280520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 272
Target Start/End: Complemental strand, 8512194 - 8512150
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaacttttt |
272 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
8512194 |
ttactttttcattatctcaattatacctttaaacaacaacttttt |
8512150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 272
Target Start/End: Complemental strand, 8518004 - 8517960
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaacttttt |
272 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
8518004 |
ttactttttcattatctcaattatacctttaaacaacaacttttt |
8517960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 10587347 - 10587307
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10587347 |
cccgtaagcttagctcagttggtagggatattgcatattat |
10587307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 14438600 - 14438544
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||| ||||||||||||| | | ||||| ||||||||||||||| ||||||| |
|
|
| T |
14438600 |
ttacttttttattatctcaattataaccttaaacaacaactttttctataataaaga |
14438544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 33617968 - 33618012
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
33617968 |
catccccgtgagcttaactcagttggtagggatattgcatattat |
33618012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 34158727 - 34158687
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggatattgcatattat |
34158687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 42880944 - 42880988
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
42880944 |
catccccgtgagcttaactcagttggtagggatattgcatattat |
42880988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 133412 - 133455
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatattat |
133455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Complemental strand, 2787150 - 2787111
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcatattat |
2787111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2792776 - 2792819
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattat |
2792819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 5328640 - 5328597
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5328640 |
atccctgtaagcttagctcagttggtagggatattgcatattat |
5328597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 6659286 - 6659329
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
6659286 |
atccccgtgagattagctcagttggtagggatattgcatattat |
6659329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 6739688 - 6739731
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
6739688 |
atccccgtgagattagctcagttggtagggatattgcatattat |
6739731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 7797127 - 7797170
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7797127 |
atccccgtaagcttagctcagttggtagggatattgaatattat |
7797170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 7816400 - 7816443
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7816400 |
atccccgtaagcttagctcagttggtagggatattgaatattat |
7816443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 8034485 - 8034442
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
8034485 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
8034442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 14876675 - 14876632
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||| |||||||||||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatattat |
14876632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 20540179 - 20540136
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattat |
20540136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 26567321 - 26567278
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
26567321 |
atccccgtgagcttagctcagttgatagggatattgcatattat |
26567278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 29514623 - 29514666
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
29514623 |
atccccgtgagcttagctcagttggtagggatattgtatattat |
29514666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 34266009 - 34266052
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34266009 |
atccccgcgagcttagctcagttggtagggatattgcatattat |
34266052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 308 - 339
Target Start/End: Complemental strand, 37535560 - 37535529
Alignment:
| Q |
308 |
ttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37535560 |
ttagctcaattggtagggatattgcatattat |
37535529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 37717360 - 37717403
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
37717403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 37838578 - 37838617
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
37838578 |
ccgtaagcttagctcaaatggtagggatattgcatattat |
37838617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 38219641 - 38219598
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatattat |
38219598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 43284039 - 43283996
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
43283996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 1286616 - 1286582
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
1286616 |
agcttatctcaattggtagggatattgcatattat |
1286582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Original strand, 5683760 - 5683794
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
5683760 |
agcttagctcaattggtaggaatattgcatattat |
5683794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 8698644 - 8698610
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8698644 |
agcttagctcagttggtagggatattgcatattat |
8698610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 296 - 338
Target Start/End: Original strand, 10568082 - 10568124
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
|||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
10568082 |
atccccgtgagtttagctcagttggtagggatattgcatatta |
10568124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 27077161 - 27077127
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27077161 |
agcttagctcagttggtagggatattgcatattat |
27077127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 34966678 - 34966731
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| |
|
|
| T |
34966678 |
ttactttttcattatctcaattataccctta---aacaactttttctataataaaga |
34966731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 297 - 339
Target Start/End: Original strand, 38402249 - 38402291
Alignment:
| Q |
297 |
tccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattat |
38402291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 41942575 - 41942522
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| |
|
|
| T |
41942575 |
ttactttttcattatctcaattataccctta---aacaactttttctataataaaga |
41942522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Original strand, 42006784 - 42006818
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42006784 |
agcttagctcagttggtagggatattgcatattat |
42006818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 297 - 335
Target Start/End: Original strand, 42877032 - 42877070
Alignment:
| Q |
297 |
tccccgtcagcttagctcaattggtagggatattgcata |
335 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
42877032 |
tccccgtgagcttagctcaattggtagggacattgcata |
42877070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 93191 - 93134
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||| ||||||||||| |||||| ||| ||||| || |||||||||||| ||||||| |
|
|
| T |
93191 |
tttacattttcattatcccaattatacccttaaacaataactttttctataataaaga |
93134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 9187298 - 9187253
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| ||| |||| |
|
|
| T |
9187298 |
tcatccccgtgagcttagctcagttggtagggatattacattttat |
9187253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 28628660 - 28628705
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| |||||| ||||||| |||||||| |
|
|
| T |
28628660 |
tcatccccgtgagcttagctcagttggtacggatattacatattat |
28628705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 284
Target Start/End: Original strand, 34180031 - 34180084
Alignment:
| Q |
231 |
ctttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||| |||||| | | ||||| ||||||||||||||| ||||||| |
|
|
| T |
34180031 |
ctttttcattatcccaattataaccttaaacaacaactttttctataataaaga |
34180084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 39587542 - 39587587
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
39587542 |
tcatccccgtgagcttagctcagttggtagagatattgcattttat |
39587587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 335
Target Start/End: Complemental strand, 8402406 - 8402370
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcata |
335 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
8402406 |
cccgtgagcttagctcaattggtagggacattgcata |
8402370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 272
Target Start/End: Complemental strand, 8514234 - 8514190
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaacttttt |
272 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
8514234 |
ttacttttttattatctcaattatacctttaaacaacaacttttt |
8514190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 307 - 339
Target Start/End: Complemental strand, 16432190 - 16432158
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
16432190 |
cttagctcagttggtagggatattgcatattat |
16432158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 290
Target Start/End: Original strand, 24688606 - 24688665
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||| ||||||||| ||||||| ||||| |
|
|
| T |
24688606 |
ttactttttcattatctcaattataccttta---aacaattttttctataataaagatcgttg |
24688665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 290
Target Start/End: Complemental strand, 27020587 - 27020528
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| |||||||||||||| ||||||| ||||| |
|
|
| T |
27020587 |
ttactttttcattatctcaattataccctta---aacaactttttctacaataaagatcgttg |
27020528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 27022873 - 27022841
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaa |
260 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
27022873 |
ttactttttcattatctcaattataccattaaa |
27022841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 34472297 - 34472337
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
34472297 |
cccgtgagcttaactcagttggtagggatattgcatattat |
34472337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 38620415 - 38620371
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| || ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
38620415 |
catccctgtgagcttagctcagttggtagggatattgtatattat |
38620371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 40362048 - 40362088
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
40362048 |
cccgtgagcttagctcagttagtagggatattgcatattat |
40362088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 51)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 607182 - 607227
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
607182 |
tcatccccgtgagcttagctcagttggtagggatattgcatattat |
607227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 7207839 - 7207884
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7207839 |
tcatccccgtgagcttagctcagttggtagggatattgcatattat |
7207884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 32166369 - 32166409
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32166369 |
cccgtgagcttagctcaattggtagggatattgcatattat |
32166409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 3794246 - 3794203
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
3794203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 4408355 - 4408398
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
4408398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 7545326 - 7545369
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7545326 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
7545369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 7865428 - 7865385
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7865428 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
7865385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 9246455 - 9246412
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9246455 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
9246412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 9372274 - 9372231
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
9372231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 9435623 - 9435666
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9435623 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
9435666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 10934596 - 10934639
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10934596 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
10934639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 15091445 - 15091488
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15091445 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
15091488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 17441912 - 17441869
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
17441869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 19953901 - 19953858
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
19953858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 30885643 - 30885600
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30885643 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
30885600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 33573814 - 33573857
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33573814 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
33573857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 298 - 339
Target Start/End: Complemental strand, 19618799 - 19618758
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
19618799 |
ccccgtgagtttagctcaattggtagggatattgcatattat |
19618758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 4661092 - 4661136
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4661092 |
catccccgtgagcttagcttagttggtagggatattgcatattat |
4661136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 8439675 - 8439715
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggatattgcatattat |
8439715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 27094881 - 27094837
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
27094881 |
catccccgtgagcttaactcagttggtagggatattgcatattat |
27094837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 216203 - 216246
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |||| |
|
|
| T |
216203 |
atcccagtgagcttagctcaattggtagggatattgcatgttat |
216246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 1968993 - 1969036
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
1968993 |
atccccgtgagcttagctcagttggtagggatattacatattat |
1969036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 2816887 - 2816930
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||| |||| |
|
|
| T |
2816887 |
atccccatgagcttagctcaattggtagggatattgcatgttat |
2816930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 3294765 - 3294804
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatattat |
3294804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 232 - 283
Target Start/End: Complemental strand, 4076007 - 4075956
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaactttttctatgataaag |
283 |
Q |
| |
|
|||||||||||| |||||| ||| ||||| ||||||||||||||| |||||| |
|
|
| T |
4076007 |
tttttcattatcacaattatacccttaaacaacaactttttctataataaag |
4075956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 5052146 - 5052103
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||| |||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttat |
5052103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 6210051 - 6210094
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
6210051 |
atccccgtgaacttagctcagttggtagggatattgcatattat |
6210094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 8297624 - 8297667
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||| |||| |
|
|
| T |
8297624 |
atccccgtgagcttagctcaattggtagggatgttgcatgttat |
8297667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 8857087 - 8857130
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattat |
8857130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 9704414 - 9704457
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
9704414 |
atccccgtgaacttagctcagttggtagggatattgcatattat |
9704457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 13732809 - 13732852
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
13732852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 19892349 - 19892306
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattat |
19892306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 21248529 - 21248572
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
21248529 |
atccccgtaagcttagctcagttggtagggatattgcattttat |
21248572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 28030861 - 28030904
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| || ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28030861 |
atccctgtgagcttagctcagttggtagggatattgcatattat |
28030904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 29284263 - 29284306
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
29284306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 31802050 - 31802093
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
31802050 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
31802093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 28712078 - 28712025
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| |
|
|
| T |
28712078 |
ttactttttcattatctcaattataccctta---aacaactttttctataataaaga |
28712025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 32611618 - 32611584
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32611618 |
agcttagctcagttggtagggatattgcatattat |
32611584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 305 - 338
Target Start/End: Original strand, 743569 - 743602
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
743569 |
agcttagctcagttggtagggatattgcatatta |
743602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 335
Target Start/End: Original strand, 2251837 - 2251874
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcata |
335 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggatattgcata |
2251874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 299 - 336
Target Start/End: Complemental strand, 3299037 - 3299000
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatat |
336 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
3299037 |
cccgtgagcttagatcaattggtagggatattgcatat |
3299000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 28148808 - 28148763
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| | | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
28148808 |
tcatccccttgaacttagctcagttggtagggatattgcatattat |
28148763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 978208 - 978164
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| || |||||||| || |||||||||||||||||||| |
|
|
| T |
978208 |
catccccgtgagtttagctcagttagtagggatattgcatattat |
978164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 3196619 - 3196659
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
3196619 |
cccgtgagcttagctcagttggtagggatattacatattat |
3196659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 4869768 - 4869728
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
4869768 |
cccgtgagcttagctcagttggtagggatactgcatattat |
4869728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 232 - 290
Target Start/End: Original strand, 10460108 - 10460163
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
||||||||||||||||||| ||| ||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
10460108 |
tttttcattatctcaattataccctta---aacaactttttctataataaagatcgttg |
10460163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 232 - 284
Target Start/End: Complemental strand, 14662427 - 14662375
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||||||||||| | |||| ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
14662427 |
tttttcattatccctattatacccttaaacaacaactttttctataataaaga |
14662375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 305 - 337
Target Start/End: Complemental strand, 15964007 - 15963975
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
15964007 |
agcttagctcagttggtagggatattgcatatt |
15963975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 32333385 - 32333329
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||||||||||||||| ||||| ||| ||||| |||||||||||| || ||||||| |
|
|
| T |
32333385 |
ttactttttcattatcctaattatacccttaaacaacaactttttccataataaaga |
32333329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 32813724 - 32813680
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
32813724 |
catccccgtgagcttagttcagttggtacggatattgcatattat |
32813680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 34432867 - 34432827
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
34432867 |
cccgtgagcttagttcagttggtagggatattgcatattat |
34432827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 76)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 7067860 - 7067803
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||| |||||||||||| |||||| ||||||||| ||||||||||||||| ||||||| |
|
|
| T |
7067860 |
tttattttttcattatcccaattataccattaaacaacaactttttctataataaaga |
7067803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 55251426 - 55251381
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55251426 |
tcatccccgtgagcttagctcagttggtagggatattgcatattat |
55251381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 40051618 - 40051662
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40051618 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
40051662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 3847678 - 3847721
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
3847721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 6371111 - 6371154
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
6371154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 8433696 - 8433653
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
8433653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 8965091 - 8965134
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
8965134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 23705227 - 23705184
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
23705227 |
catccccgtgagcttagctcagttggtagggatattgcatatta |
23705184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 24680159 - 24680116
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
24680116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 26868346 - 26868389
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26868346 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
26868389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 26919541 - 26919498
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26919541 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
26919498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 37935858 - 37935901
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
37935901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 39023172 - 39023215
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39023172 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
39023215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 43147457 - 43147414
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
43147414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 43207666 - 43207709
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
43207709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 43596892 - 43596935
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43596892 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
43596935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 46105532 - 46105575
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
46105575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 46775103 - 46775060
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46775103 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
46775060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 48569249 - 48569206
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48569249 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
48569206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 49901479 - 49901522
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49901479 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
49901522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 29771363 - 29771329
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29771363 |
agcttagctcaattggtagggatattgcatattat |
29771329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 338
Target Start/End: Complemental strand, 35219573 - 35219531
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatta |
338 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
35219573 |
atccccgtgagcttagctcagttggtagggatattgcatatta |
35219531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 33530788 - 33530833
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33530788 |
tcatcctcgtgagcttagcttaattggtagggatattgcatattat |
33530833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Original strand, 44602480 - 44602525
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
44602480 |
tcatccccgtgagcttagctcagttggtagggatattgcattttat |
44602525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 296 - 337
Target Start/End: Original strand, 45849044 - 45849085
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45849044 |
atccccgtgagcttagctcagttggtagggatattgcatatt |
45849085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 46620728 - 46620671
Alignment:
| Q |
227 |
tttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||| ||||| ||||||||||||| ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
46620728 |
tttatttttttattatctcaattatacccttaaacaacaactttttctataataaaga |
46620671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 1458092 - 1458048
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1458092 |
catccccgtaagcttagctcagttgatagggatattgcatattat |
1458048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 3764082 - 3764038
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
3764082 |
catccccgtgagcttagctcagttggtagggatattacatattat |
3764038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 232 - 284
Target Start/End: Complemental strand, 7438340 - 7438288
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||||||||||| |||||| ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
7438340 |
tttttcattatcccaattatacccttaaacaacaactttttctataataaaga |
7438288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 22230504 - 22230464
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggatattgcatattat |
22230464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 22788744 - 22788704
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22788744 |
cccgtgagcttagctcagttggtagggatattgcatattat |
22788704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 25235871 - 25235827
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25235871 |
catccccgtgagcttagcttagttggtagggatattgcatattat |
25235827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 40994173 - 40994133
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggatattgcatattat |
40994133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 43978008 - 43978048
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggatattgcatattat |
43978048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 45112185 - 45112141
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45112185 |
catccccgtgagcttacctcagttggtagggatattgcatattat |
45112141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 47934146 - 47934102
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
47934146 |
catccccgtgagcttagctcagttggtagggatatggcatattat |
47934102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 3036128 - 3036085
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
3036085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 335
Target Start/End: Original strand, 3784913 - 3784948
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcata |
335 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3784913 |
ccgtgagcttagctcaattggtagggatattgcata |
3784948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 4234358 - 4234315
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
4234358 |
atccccgtgagcttagctcagttgatagggatattgcatattat |
4234315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 4590243 - 4590286
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||| ||||||||||||||||||||||| |
|
|
| T |
4590243 |
atccccgtgagtttagctcagttggtagggatattgcatattat |
4590286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 4958629 - 4958586
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattat |
4958586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 9761112 - 9761155
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattat |
9761155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 11375962 - 11375919
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
11375962 |
atccccgtgagcttagctcagttgatagggatattgcatattat |
11375919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 335
Target Start/End: Original strand, 17872084 - 17872123
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcata |
335 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
17872084 |
atccccgtgagcttagcttaattggtagggatattgcata |
17872123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 21380255 - 21380212
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
21380255 |
atccccgtgagtttagctcaattgctagggatattgcatattat |
21380212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 21935474 - 21935517
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21935474 |
atccccgcaagcttagctcagttggtagggatattgcatattat |
21935517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 30217600 - 30217639
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30217600 |
ccgtgagcttagctcagttggtagggatattgcatattat |
30217639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 339
Target Start/End: Original strand, 34353780 - 34353819
Alignment:
| Q |
300 |
ccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34353780 |
ccgtgagcttagctcagttggtagggatattgcatattat |
34353819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 35465432 - 35465475
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggatattgcattttat |
35465475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 36132226 - 36132269
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| || ||||||||||||||||| |||||||||||||| |
|
|
| T |
36132226 |
atccccgtgagtttagctcaattggtaggaatattgcatattat |
36132269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 42218747 - 42218790
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
42218747 |
atccccgtgaacttagctcagttggtagggatattgcatattat |
42218790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 45126129 - 45126172
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
45126129 |
atccccgtgagcttagctcagttggtagggatattgtatattat |
45126172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 48798276 - 48798319
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
48798276 |
atccccgtgagcttagctcagttggtagggatattgcattttat |
48798319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 51512082 - 51512039
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
51512082 |
atccccgtgagctgagctcagttggtagggatattgcatattat |
51512039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 52798275 - 52798318
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
52798275 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
52798318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 53376752 - 53376709
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
53376752 |
atccccgcgagcttagctcaattggtagggatattgcatgttat |
53376709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 55238572 - 55238529
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
55238572 |
atccccgtgagcttagcttagttggtagggatattgcatattat |
55238529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 55536377 - 55536420
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattat |
55536420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 55853181 - 55853138
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
55853181 |
atccccgtgagcttagctcagttggtagagatattgcatattat |
55853138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 232 - 282
Target Start/End: Complemental strand, 27551152 - 27551102
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaactttttctatgataaa |
282 |
Q |
| |
|
|||||||||||| |||||| ||| ||||| ||||||||||||||| ||||| |
|
|
| T |
27551152 |
tttttcattatcccaattatacccttaaacaacaactttttctataataaa |
27551102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 35447755 - 35447702
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| |||||||||||| ||||||| |
|
|
| T |
35447755 |
ttactttttcattatctcaattatacccttaaat---aactttttctataataaaga |
35447702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 39696401 - 39696367
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39696401 |
agcttagctcagttggtagggatattgcatattat |
39696367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 51400214 - 51400161
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
51400214 |
ttactttttcattatcccaattataccattaaat---aactttttctataataaaga |
51400161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 306 - 339
Target Start/End: Complemental strand, 25726372 - 25726339
Alignment:
| Q |
306 |
gcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
25726372 |
gcttagctcagttggtagggatattgcatattat |
25726339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 49757359 - 49757314
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||| ||||||| |||||||| |||||||||||||| |
|
|
| T |
49757359 |
tcatccccgtgagcatagctcagttggtaggaatattgcatattat |
49757314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 3815060 - 3815100
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
3815060 |
cccgtgagcttagcttagttggtagggatattgcatattat |
3815100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 10417295 - 10417251
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| | ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
10417295 |
catccccatgagcttagctcagttggtagggatattacatattat |
10417251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 24997504 - 24997464
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
24997504 |
cccgtgagcttagctcagttggtagggatattgcattttat |
24997464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 27743778 - 27743738
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
27743778 |
cccgtgagcgtagctcagttggtagggatattgcatattat |
27743738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 28494873 - 28494929
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
|||| ||||||||||| |||||| || ||||| ||||||||||||||| ||||||| |
|
|
| T |
28494873 |
ttaccttttcattatcccaattatactcttaaacaacaactttttctataataaaga |
28494929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 337
Target Start/End: Original strand, 37251111 - 37251151
Alignment:
| Q |
297 |
tccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatatt |
37251151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 276
Target Start/End: Original strand, 37830912 - 37830960
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctat |
276 |
Q |
| |
|
|||| ||||||||||| |||||| ||| ||||| ||||||||||||||| |
|
|
| T |
37830912 |
ttacattttcattatcccaattatacccttaaacaacaactttttctat |
37830960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 39697932 - 39697892
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
39697932 |
cccgtgagcttagctcagttgatagggatattgcatattat |
39697892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 45673648 - 45673692
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| |||||| |||| |||||||| |||||||||||||| |
|
|
| T |
45673648 |
catccccgtgagcttaactcagttggtaggaatattgcatattat |
45673692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 49447117 - 49447161
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||| | ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
49447117 |
catccccatgagcttagctcagttggtaaggatattgcatattat |
49447161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 50457784 - 50457744
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
50457784 |
cccgtgagcttagctcagttggtaaggatattgcatattat |
50457744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Original strand, 8962 - 9006
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8962 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
9006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 295 - 339
Target Start/End: Complemental strand, 4088 - 4044
Alignment:
| Q |
295 |
catccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4088 |
catccccgtgagcttagctcagttggtagggatattgcatattat |
4044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 93 - 50
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
93 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
50 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 17617 - 17660
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
17660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 46523 - 46566
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46523 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
46566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 307 - 339
Target Start/End: Original strand, 12002 - 12034
Alignment:
| Q |
307 |
cttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
12002 |
cttagctcagttggtagggatattgcatattat |
12034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 45881 - 45924
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 10899 - 10856
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
10856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 59780 - 59823
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
59780 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
59823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 296 - 339
Target Start/End: Complemental strand, 266770 - 266727
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
266770 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
266727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 294 - 339
Target Start/End: Complemental strand, 2448 - 2403
Alignment:
| Q |
294 |
tcatccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2448 |
tcatccccgtgagcgtagctcagttggtagggatattgcatattat |
2403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 296 - 337
Target Start/End: Complemental strand, 8898 - 8857
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatatt |
337 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8898 |
atccccgtgagcttagctcagttggtagggatattgcatatt |
8857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 930 - 890
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggatattgcatattat |
890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 299 - 339
Target Start/End: Complemental strand, 12331 - 12291
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggatattgcatattat |
12291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 397 - 440
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| | ||||||||||||| ||||||||||||||||||| |
|
|
| T |
397 |
atccccgtgaacttagctcaattgatagggatattgcatattat |
440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 12456 - 12499
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattat |
12499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 306 - 339
Target Start/End: Complemental strand, 13266 - 13233
Alignment:
| Q |
306 |
gcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
13266 |
gcttagctcagttggtagggatattgcatattat |
13233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 8818 - 8861
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
8818 |
atccccgtgagcttagctcagttggtagggatattgcattttat |
8861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 296 - 339
Target Start/End: Original strand, 112105 - 112148
Alignment:
| Q |
296 |
atccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
112105 |
atccccgtgagcttaactcagttggtagggatattgcatattat |
112148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 305 - 339
Target Start/End: Complemental strand, 65851 - 65817
Alignment:
| Q |
305 |
agcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
65851 |
agcttagctcagttggtagggatattgcatattat |
65817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 306 - 339
Target Start/End: Original strand, 1871 - 1904
Alignment:
| Q |
306 |
gcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattat |
1904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 339
Target Start/End: Original strand, 21263 - 21304
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
21263 |
ccccgtgagcttagcttagttggtagggatattgcatattat |
21304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 298 - 339
Target Start/End: Original strand, 5981 - 6022
Alignment:
| Q |
298 |
ccccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
5981 |
ccccgtgagcttagctcatttgatagggatattgcatattat |
6022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0734 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0734
Description:
Target: scaffold0734; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 3747 - 3787
Alignment:
| Q |
163 |
gaatctat-cttactttttcattattccaattatatcctta |
202 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
3747 |
gaatctatacttactttttcattgttccaattatatcctta |
3787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 3666 - 3706
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
3666 |
cccgtgagcttaactcagttggtagggatattgcatattat |
3706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0285 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0285
Description:
Target: scaffold0285; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 290
Target Start/End: Complemental strand, 16718 - 16659
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaagaccgttg |
290 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| |||||||||||| || ||||||| ||||| |
|
|
| T |
16718 |
ttactttttcattatcttaattacaccctta---aacaactttttcaataataaagatcgttg |
16659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0196 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0196
Description:
Target: scaffold0196; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 232 - 284
Target Start/End: Complemental strand, 9284 - 9232
Alignment:
| Q |
232 |
tttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||| ||||||| ||||| ||| ||||| ||||||||||||||| ||||||| |
|
|
| T |
9284 |
ttttttattatcttaattatacccttaaacaacaactttttctataataaaga |
9232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 299 - 339
Target Start/End: Original strand, 56323 - 56363
Alignment:
| Q |
299 |
cccgtcagcttagctcaattggtagggatattgcatattat |
339 |
Q |
| |
|
||||| |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
56323 |
cccgtgagcttaactcaattggcagggatattgcatattat |
56363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 57068 - 57124
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| || || |||||||| ||||||| |
|
|
| T |
57068 |
ttactttttcattatctcaattatacccttaaacaataatattttctataataaaga |
57124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 228 - 284
Target Start/End: Original strand, 64193 - 64249
Alignment:
| Q |
228 |
ttactttttcattatctcaattacaccattaaataacaactttttctatgataaaga |
284 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| || || |||||||| ||||||| |
|
|
| T |
64193 |
ttactttttcattatctcaattatacccttaaacaataatattttctataataaaga |
64249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University