View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_high_86 (Length: 277)
Name: NF3002_high_86
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_high_86 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 259
Target Start/End: Complemental strand, 45191149 - 45190901
Alignment:
| Q |
11 |
cacagaaacctattagtgaaactaggtggcgatgtcgcagcttagaaagcatgtttagttcggttctgaactcatttattccttgctcagaaccaccacc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45191149 |
cacagaaacctattagtgaaactaggtggcgatgtcgcagcttagaaagcatctttagttcggttctgaactcatttattccttgctcagaaccaccacc |
45191050 |
T |
|
| Q |
111 |
tcctctttttacagcaacatttgttccatcatccaatgtcccaaggtacactttaccaaatcctccataaccaatcactctcttttcatcaaaattatct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45191049 |
tcctctttttacagcaacatttgttccatcatccaatgtcccaaggtacactttaccaaatcctccataaccaatcactctcttttcatcaaaattatct |
45190950 |
T |
|
| Q |
211 |
gtagctcgttgcaattcgatgaaatgaaagaaccttcctgtccctcttg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45190949 |
gtagctcgttgcaattcgatgaaatgaaagaaccttcctgtccctcttg |
45190901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University