View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_high_96 (Length: 253)
Name: NF3002_high_96
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_high_96 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 253
Target Start/End: Complemental strand, 38632381 - 38632143
Alignment:
| Q |
15 |
atgaacaatgatacagttaaataatgatccttgagtaactggttttggtaaaagacttaccaaggtcaaccataagtgatacatgtatccttaaaaatca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38632381 |
atgaacaatgatacagttaaataatgatccttgagtaaccggttttggcaaaagacttaccaaggtcaaccataagtgatacatgtatccttaaaaatca |
38632282 |
T |
|
| Q |
115 |
cttcctatgatagcgttaacattgcattgatgttagtatttgtatcaataatatacttaccgtgtgttactttgtaaattgtatgaagggggtaaaataa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
38632281 |
cttcctatgatagcgttaacattgcattgatgttagtatttgtaccaataatatacttaccgtgtgttactttgtaaattgtatgaagggggtataataa |
38632182 |
T |
|
| Q |
215 |
ggagtaatgtgaaagaggttcgaggtttggcctctggta |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38632181 |
ggagtaatgtgaaagaggttcgaggtttggcctctggta |
38632143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University