View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_115 (Length: 248)
Name: NF3002_low_115
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_115 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 45 - 192
Target Start/End: Complemental strand, 11383845 - 11383698
Alignment:
| Q |
45 |
aagagctataatggttattttaatgttggtcaaaattggttatgatatgtactaaagtagtcaagtagnnnnnnncttggtaatcaactagttaaatatc |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11383845 |
aagagctataatggttattttaatgttggtcaaaattggttatgatatgtggcaaagtagtcaagtagtgtttttcttggtaatcaactagttaaatatc |
11383746 |
T |
 |
| Q |
145 |
tcattgatccctgtattttttatcatattttagcattgattcttgcac |
192 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11383745 |
tcattggtccctgtatttcttatcatattttagcattgattcttgcac |
11383698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 11384148 - 11384110
Alignment:
| Q |
1 |
ccttaagacacatatatatagccccaaggggcttagcca |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11384148 |
ccttaagacacatatatatagccccaaggggcttagcca |
11384110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University