View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_117 (Length: 248)
Name: NF3002_low_117
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_117 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 51938348 - 51938581
Alignment:
| Q |
1 |
agttataatgctttatattttatattgaaaatagctgatttgtctactagcagttgtagagaagttgtaaactttgtctccgtacaaaacattctttaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51938348 |
agttataatgctttatattttatattgaaaatagctgatttgtctattagcagttgcagagaagttgtaaactttgtctctgtacaaaacattctttaac |
51938447 |
T |
 |
| Q |
101 |
caattgcggtcacttataaattggaacgcatacggagacagatcttttgaaaacaatgtggcgataatacaaacattgttacatcagaagaaacgtaaaa |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938448 |
caattgcggtcacttatttattggaacgcatacggagacagatcttttgaaaacaatgtggcgataatacaaacattgttacatcagaagaaacgtaaaa |
51938547 |
T |
 |
| Q |
201 |
agaatttgaagtatctttagagcttgattcatct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
51938548 |
agaatttgaagtatctttagagcttgatttatct |
51938581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University