View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3002_low_120 (Length: 247)

Name: NF3002_low_120
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3002_low_120
NF3002_low_120
[»] chr7 (1 HSPs)
chr7 (1-152)||(30761123-30761274)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 30761274 - 30761123
Alignment:
1 tggtcttgagtgagaccannnnnnnngtcttattattgggatttctttatttaaattatattttggatctaaacgaatctaaatcaagatttcatataac 100  Q
    ||||||||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30761274 tggtcttgagtgagaccattttttttgtcttattattgggatttctttatttaaattatattttggatctaaacgaatctaaatcaagatttcatataac 30761175  T
101 tatttcagccggttggtggtagaacaccgtagaattttaactactacacttt 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
30761174 tatttcagccggttggtggtagaacaccgtagaattttaactactacacttt 30761123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University