View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_121 (Length: 246)
Name: NF3002_low_121
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_121 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 62 - 182
Target Start/End: Original strand, 421436 - 421556
Alignment:
| Q |
62 |
gctatgctaaatgggttgtgcgcttaaaagatctcactttcaccctaaaaaagctgaacacttttgtctccatctcctcatctctctctaccaataggaa |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
421436 |
gctatgctaaatgggttgtgcgcttaaaagatctcactttcaccctaaaaaagctgaacacttttgtctccatctcctcatctctctctaccaataggaa |
421535 |
T |
 |
| Q |
162 |
agttactcttgtaactcaatt |
182 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
421536 |
agttactcttgtaactcaatt |
421556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University