View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_124 (Length: 245)
Name: NF3002_low_124
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_124 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 35446267 - 35446041
Alignment:
| Q |
1 |
acacccgccgtctcttcctctctgtcaccgaccccgattccttcctctttaattccctcatcaaagcctcttcccagcacggtttctcccttgacactat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446267 |
acacccgccgtctcttcctctctgtcaccgaccccgattccttcctctttaattccctcatcaaagcctcttcccagcacggtttctcccttgacactat |
35446168 |
T |
|
| Q |
101 |
ctttttctaccgtcgtatgctttcttcccctcacaaaccttcttcctacactttcacctccgttttcaaagcatgtgctcatctttctgctcttaaaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446167 |
ctttttctaccgtcgtatgctttcttcccctcacaaaccttcttcctacactttcacctccgttttcaaagcatgtgctcatctttctgctcttaaaata |
35446068 |
T |
|
| Q |
201 |
ggaaccattcttcattctcatgttttc |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35446067 |
ggaaccattcttcattctcatgttttc |
35446041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University