View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3002_low_129 (Length: 239)

Name: NF3002_low_129
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3002_low_129
NF3002_low_129
[»] chr2 (1 HSPs)
chr2 (17-239)||(38631914-38632139)
[»] chr4 (1 HSPs)
chr4 (88-136)||(30584784-30584832)


Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 38631914 - 38632139
Alignment:
17 atttcatgatataagtaagcaaacacatgtgatattggcttatgactttggagtgtactcctc---aaaattttaggttcgattatctccgttgtcaaat 113  Q
    |||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||    ||||||| || ||||||||||||||||||||| |    
38631914 atttcatgatataagtcagcaaacacatatgatattggcttatgactttgaagtgtactccttcttaaaatttcagattcgattatctccgttgtcaatt 38632013  T
114 tagatggactaatatagtttctttcttcttaannnnnnnnnn-gaacaaacacaagtcttaattcaaaaatccaattgtatatgatagtgatattagtgg 212  Q
    ||||||||||||| || |||||| ||||||||           |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
38632014 tagatggactaatttaatttctt-cttcttaatttttttttttgaacaaacacaagtcttaattcaaaaatccaattatatatgatagtgatattagtgg 38632112  T
213 ttaatttattataatgtcatggaaaat 239  Q
    |||||||||||||||||||||||||||    
38632113 ttaatttattataatgtcatggaaaat 38632139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 136
Target Start/End: Complemental strand, 30584832 - 30584784
Alignment:
88 aggttcgattatctccgttgtcaaattagatggactaatatagtttctt 136  Q
    ||||||||||||||||| |||||| |||||||  ||||| |||||||||    
30584832 aggttcgattatctccgatgtcaatttagatgagctaatttagtttctt 30584784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University