View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3002_low_132 (Length: 238)

Name: NF3002_low_132
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3002_low_132
NF3002_low_132
[»] chr4 (1 HSPs)
chr4 (18-238)||(42631760-42631980)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 42631980 - 42631760
Alignment:
18 ttaacgagtctttcacttttattctagataacatttatttgcatttgaatttaattcaatatttaaattgagagtcatcttcagtcttgcacttttgttt 117  Q
    |||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||  |||||||| |||| |||||||||||    
42631980 ttaacgagtctttcacttttattctagataacatgtatttgtatttgaatttaattcaatatttaaattgagaaacatcttcaatcttacacttttgttt 42631881  T
118 tagataacatgaatttctgtttaaacttgattcaatattgataaatattttagtttattagatatttggtccatactttgatctttaatcgttgcatatg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
42631880 tagataacatgaatttctgtttaaacttgattcaatattgataaatattttagtttattagatatttggtccatagtttgatctttaatcgttgcatatg 42631781  T
218 agaaaatatatattggaatat 238  Q
    |||||||||||||||||||||    
42631780 agaaaatatatattggaatat 42631760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University