View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_144 (Length: 223)
Name: NF3002_low_144
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_144 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 35902567 - 35902785
Alignment:
| Q |
1 |
ttgaagcttgcaatttcatctctgttatttgcttgaccattacatactgttgctgtcgcggactgctgctgcttctgtcacggcctactgctgacttccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35902567 |
ttgaagcttgcaatttcatctctgttatttgcttgaccattacatactgttgctgtcgcggactgctgctgcttctgtcacggcctactgctgacttccg |
35902666 |
T |
|
| Q |
101 |
ggtctgctacagctgctattgcggaattatgatgcttctgtcacggcctgctgctgcctctttcttggtctacggtttctgtctcgcactgctgatgcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
35902667 |
ggtctgctacagctgctattgcggaattatgatgcttctgtcacggcctgctgctgcctctttcttggtctacggctgctgtctcgcactgctgatgcta |
35902766 |
T |
|
| Q |
201 |
ctgtcacgttttgctgcta |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35902767 |
ctgtcacgttttgctgcta |
35902785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University