View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_147 (Length: 215)
Name: NF3002_low_147
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_147 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 21250698 - 21250506
Alignment:
| Q |
1 |
atgcatttgttgttgtgcatacaacaaatccactgctgttagttgttgaggaatcagtttgagaacctgtagtcccgccaacgcataagcgcgatgtacc |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
21250698 |
atgcatttcttgttgtgcatacaacaaatccactgctgttagttgttgaggaatcagtttgagaacctgtagacccgccaacgcataagcaggatgtacc |
21250599 |
T |
 |
| Q |
101 |
ttgattaattgcaatcgggtgaatgaagttggtaaacgctgcattccttaaggaacatattttcgtcaatcattatcatagtgatttagaaag |
193 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21250598 |
ttgattaattgcaatcgggtgaatgaaactggtaaacgctgcattccttaagggacatattttcgtcaatcattatcatagtgatttagaaag |
21250506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 21354336 - 21354380
Alignment:
| Q |
1 |
atgcatttgttgttgtgcatacaacaaatccactgctgttagttg |
45 |
Q |
| |
|
||||| |||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
21354336 |
atgcagttgttgttgtgcatacaacagagccactgctgttagttg |
21354380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 45
Target Start/End: Complemental strand, 47842700 - 47842658
Alignment:
| Q |
3 |
gcatttgttgttgtgcatacaacaaatccactgctgttagttg |
45 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||| |||| |
|
|
| T |
47842700 |
gcatttgttgctgtgcatacaacaaagccactgctgttggttg |
47842658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University