View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_50 (Length: 393)
Name: NF3002_low_50
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_50 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 7e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 166 - 290
Target Start/End: Original strand, 32951023 - 32951147
Alignment:
| Q |
166 |
tattcagccttcttaatttcatgttcagcttcaatcattctcaattcagctctctctatttgaacttcagccaattcctcctcttcaggtttcgtcattc |
265 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32951023 |
tattcagccatcttaatttcatgttcagcttcaatcattctcaattcagctctctctatttgaacttcagccaattcctcctcttcaggtttcgtcattc |
32951122 |
T |
 |
| Q |
266 |
tgtcctcactctccttttgaatgaa |
290 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32951123 |
tgtcctcactctccttttgaatgaa |
32951147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 32950858 - 32950939
Alignment:
| Q |
1 |
tttctttcatgggcactctgcctttgttctacagcatccttaaattcaatttcagctttgatcatataccattcagctctct |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32950858 |
tttctttcatgggcactctgcctttgttctacagcatccttaaattcaatttcagctttgatcatataccattcagctctct |
32950939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University