View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_63 (Length: 368)
Name: NF3002_low_63
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_63 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 19 - 358
Target Start/End: Original strand, 27098977 - 27099316
Alignment:
| Q |
19 |
acctcttcctcctcccatcacttccactacctcctccaccggaatattccatcatctgatccgacattgcagcagccgcggcactctcccttgtgatcgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27098977 |
acctcttcctcctcccatcacttccactacctcctccaccggaatattccatcatctgatccgacattgcagcagccgcggcactctcccttgtgatcgc |
27099076 |
T |
|
| Q |
119 |
ggttattttgcggtggaagttccggtgacagccgcaggctgcacattggaggctgtttaccgcggatggcgatgagtcatcgatggtgaattcaccgcag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27099077 |
ggttattttgcggtggaagttccggtgacagccgcaggctgcacattggaggctgtttaccgcggatggcgatgagtcgtcgatggtgaattcaccgcag |
27099176 |
T |
|
| Q |
219 |
ccgtcggtggcgtagcttccaaggcttgctgcatggtttcttaaacactctctgtagatatagttttgtgaatgtgatgatgaagatgataacattcctc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099177 |
ccgtcggtggcgtagcttccaaggcttgctgcatggtttcttaaacactctctgtagatatagttttgtgaatgtgatgatgaagatgataacattcctc |
27099276 |
T |
|
| Q |
319 |
ctccttccattgtttttatttattattttctctctctctg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099277 |
ctccttccattgtttttatttattattttctctctctctg |
27099316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University