View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_64 (Length: 356)
Name: NF3002_low_64
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 17 - 339
Target Start/End: Complemental strand, 9496936 - 9496614
Alignment:
| Q |
17 |
aggtaaggtaacatccggctgtataattaaacacccacaatgaacaccaacatatatgtatctagtaggacttaagcaacaatctttcttacatgttcct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496936 |
aggtaaggtaacatccggctgtataattaaacacccacaatgaacaccaacatatatgtatctagtaggacttaagcaacaatctttcttacatgttcct |
9496837 |
T |
 |
| Q |
117 |
ggtcacgtgctatctgtgacattgcaatcaggcggtcctgcagcaaggcagcaggtaaaggttggatcagaggctgtactgcaatgtttttacctctcca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496836 |
ggtcacgtgctatctgtgacattgcaatcaggcggtcctgcagcaaggcagcaggtaaaggttgaatcagaggctgtactgcaatgtttttacctctcca |
9496737 |
T |
 |
| Q |
217 |
agaaggccacacaacttcagcaccatccattcttaaacaaccatcctctaaattacttccatcatgataccagcctctcattccccagtgtcttgggctg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496736 |
agaaggccacacaacttcagcaccatccattcttaaacaaccatcctctaaattacttccatcatgataccagcctctcattccccagtgtcttgggctg |
9496637 |
T |
 |
| Q |
317 |
gaactaccagacctaacagttgg |
339 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9496636 |
gaactaccagacctaacagttgg |
9496614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University