View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_66 (Length: 353)
Name: NF3002_low_66
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_66 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 217 - 338
Target Start/End: Complemental strand, 40006222 - 40006101
Alignment:
| Q |
217 |
tctgaatccaaatactggtcttccttcaaaacccaacaaatccctaaacaattctctatcccttccatcaccttctccccaaatccaccctattccttcg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006222 |
tctgaatccaaatactggtcttccttcaaaacccaacaaatccctaaacaattctctatcccttccatcaccttctccccaaatccaccctattccttcg |
40006123 |
T |
 |
| Q |
317 |
tcgccgctaattcagcctctct |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40006122 |
ccgccgctaattcagcctctct |
40006101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 40006423 - 40006282
Alignment:
| Q |
8 |
ctctactctactatcatttgtcgcgccgtgcctccctcat---tcttaaaccctaaaaaaccagcaaacgaataagacaaagacagtgttggaggtttag |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
40006423 |
ctctactctactatcatttgtcgcgccgtgcctccctcattcttcttaaaccctaaaaaaccagcaaacgaat------aagacagtgttgaaggtttag |
40006330 |
T |
 |
| Q |
105 |
cagcttcttcttcaaccatcatatcatatcatcaatggaggaagcaagagtat |
157 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40006329 |
cagcttcttcttcaacc-----atcatatcatcaatggaggaagcaagagtat |
40006282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University