View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3002_low_68 (Length: 348)
Name: NF3002_low_68
Description: NF3002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3002_low_68 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 39784691 - 39784359
Alignment:
| Q |
1 |
gccagagcttgatggggaatgtgagagcatattagcagagttttcatcaaattttaaaaaggttgtccctcaagnnnnnnngaaaagattaaggaagagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39784691 |
gccagagcttgatggggaatgtgagagcatattagcagagttttcatcaaattttaaaaaggttgtccctcaagtttttttgaaaagattaaggaagagt |
39784592 |
T |
 |
| Q |
101 |
ttcttgctttttcttcagagatcttcttgttctgttgttttcttgttcagcagaaaattgtgatatatacttcaattcttacaaggttagaacctatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39784591 |
ttcttgctttttcttcagagatcttcttgttctgttgttttcttgttctgcagaaaattgtgatatatacttcaattcttacaaggttagaacctatatt |
39784492 |
T |
 |
| Q |
201 |
tcatttctttcttctaccttatgctatggaattatgttatgtgctttcttattttctaacttgacttttgttacatgttttgctttaaatttttcacagt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39784491 |
tcatttctttcttctaccttatgctatggaattatgttatgtgctttcttattttctaacttgacttttgtttcatgttttgctttaaatttttcacagt |
39784392 |
T |
 |
| Q |
301 |
tatatcatgtcatttgtgtgatagttttgtttt |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39784391 |
tatatcatgtcatttgtgtgatagttttgtttt |
39784359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University